Incidental Mutation 'R7517:Ddx21'
ID582529
Institutional Source Beutler Lab
Gene Symbol Ddx21
Ensembl Gene ENSMUSG00000020075
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 21
SynonymsD10Wsu42e, RH II/Gu, D10Ertd645e, RH-II/Gualpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62580251-62602281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62588790 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 544 (P544L)
Ref Sequence ENSEMBL: ENSMUSP00000042691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045866]
PDB Structure Gu_alpha_helicase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045866
AA Change: P544L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042691
Gene: ENSMUSG00000020075
AA Change: P544L

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 107 139 N/A INTRINSIC
internal_repeat_1 140 160 2.96e-8 PROSPERO
low complexity region 162 171 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
internal_repeat_1 214 234 2.96e-8 PROSPERO
DEXDc 277 484 2.76e-56 SMART
HELICc 524 604 1.55e-27 SMART
low complexity region 682 688 N/A INTRINSIC
Pfam:GUCT 692 787 1.6e-33 PFAM
low complexity region 827 843 N/A INTRINSIC
Meta Mutation Damage Score 0.2362 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Ddx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Ddx21 APN 10 62598402 nonsense probably null
IGL01144:Ddx21 APN 10 62598550 missense unknown
IGL01655:Ddx21 APN 10 62587491 missense probably damaging 0.98
IGL01694:Ddx21 APN 10 62598651 nonsense probably null
IGL01752:Ddx21 APN 10 62587507 missense probably damaging 1.00
IGL02827:Ddx21 APN 10 62598374 missense probably benign 0.04
IGL03140:Ddx21 APN 10 62594071 missense probably damaging 1.00
IGL03248:Ddx21 APN 10 62591990 missense possibly damaging 0.87
R0131:Ddx21 UTSW 10 62584752 missense possibly damaging 0.96
R0555:Ddx21 UTSW 10 62587528 missense probably damaging 1.00
R1437:Ddx21 UTSW 10 62598590 missense unknown
R1780:Ddx21 UTSW 10 62594147 splice site probably benign
R1875:Ddx21 UTSW 10 62594068 missense probably damaging 1.00
R2696:Ddx21 UTSW 10 62594092 missense possibly damaging 0.93
R4639:Ddx21 UTSW 10 62591837 nonsense probably null
R4678:Ddx21 UTSW 10 62594003 missense probably benign 0.06
R4767:Ddx21 UTSW 10 62591972 missense probably damaging 1.00
R4799:Ddx21 UTSW 10 62588121 missense probably damaging 0.98
R5145:Ddx21 UTSW 10 62587539 critical splice acceptor site probably null
R5243:Ddx21 UTSW 10 62602213 start codon destroyed probably null 0.02
R6085:Ddx21 UTSW 10 62594087 missense probably damaging 1.00
R6701:Ddx21 UTSW 10 62590691 missense probably damaging 1.00
R7134:Ddx21 UTSW 10 62591855 missense possibly damaging 0.95
R7555:Ddx21 UTSW 10 62598243 missense probably benign 0.03
R7577:Ddx21 UTSW 10 62590670 missense probably benign 0.19
R7704:Ddx21 UTSW 10 62594086 missense probably damaging 1.00
R8902:Ddx21 UTSW 10 62598707 missense probably benign 0.01
Z1177:Ddx21 UTSW 10 62587538 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGAAAACTGCATAAAAGTCAG -3'
(R):5'- GTGCAAGAAGACATCTGCTCTTC -3'

Sequencing Primer
(F):5'- GTCAGTGAAAGGACTTTTAGTAACAC -3'
(R):5'- AGAGGTCTTGAGTTCCCTGCAAC -3'
Posted On2019-10-17