Incidental Mutation 'R7517:Hnrnph3'
ID 582530
Institutional Source Beutler Lab
Gene Symbol Hnrnph3
Ensembl Gene ENSMUSG00000020069
Gene Name heterogeneous nuclear ribonucleoprotein H3
Synonyms hnRNP 2H9, Hnrph3
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.568) question?
Stock # R7517 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 63014664-63024217 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63018895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 39 (L39S)
Ref Sequence ENSEMBL: ENSMUSP00000020263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119567] [ENSMUST00000119814] [ENSMUST00000140743] [ENSMUST00000143594]
AlphaFold D3Z3N4
Predicted Effect unknown
Transcript: ENSMUST00000020263
AA Change: L39S
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069
AA Change: L39S

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118898
AA Change: L39S
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069
AA Change: L39S

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119567
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119814
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140743
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Meta Mutation Damage Score 0.5066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Hnrnph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hnrnph3 APN 10 63018124 makesense probably null
IGL02112:Hnrnph3 APN 10 63016405 critical splice donor site probably null
IGL02116:Hnrnph3 APN 10 63016076 intron probably benign
IGL02193:Hnrnph3 APN 10 63017277 missense probably damaging 0.98
IGL02211:Hnrnph3 APN 10 63017342 unclassified probably benign
IGL02410:Hnrnph3 APN 10 63015724 intron probably benign
IGL02616:Hnrnph3 APN 10 63019485 missense possibly damaging 0.66
IGL03033:Hnrnph3 APN 10 63018179 missense probably benign 0.00
IGL03367:Hnrnph3 APN 10 63017229 missense probably damaging 1.00
R0450:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0450:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R0469:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R1585:Hnrnph3 UTSW 10 63015800 critical splice donor site probably null
R4285:Hnrnph3 UTSW 10 63016468 missense probably damaging 1.00
R4706:Hnrnph3 UTSW 10 63017280 missense probably damaging 1.00
R5606:Hnrnph3 UTSW 10 63019443 missense possibly damaging 0.94
R5873:Hnrnph3 UTSW 10 63019391 critical splice donor site probably null
R5952:Hnrnph3 UTSW 10 63015595 intron probably benign
R6059:Hnrnph3 UTSW 10 63018862 unclassified probably benign
R6644:Hnrnph3 UTSW 10 63018893 unclassified probably benign
R9374:Hnrnph3 UTSW 10 63018178 missense probably benign 0.01
R9436:Hnrnph3 UTSW 10 63018848 nonsense probably null
R9437:Hnrnph3 UTSW 10 63018848 nonsense probably null
R9781:Hnrnph3 UTSW 10 63018082 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTTACCCACCCCATTTAAG -3'
(R):5'- GAGTTACCATTGGGAGCACAG -3'

Sequencing Primer
(F):5'- CACCCCATTTAAGCAACAGTG -3'
(R):5'- GTTACCATTGGGAGCACAGTTAATG -3'
Posted On 2019-10-17