Incidental Mutation 'R7517:Olfr401'
ID582532
Institutional Source Beutler Lab
Gene Symbol Olfr401
Ensembl Gene ENSMUSG00000070380
Gene Nameolfactory receptor 401
SynonymsMOR255-6, GA_x6K02T2P1NL-4278037-4278984
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74113712-74122941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74121509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 73 (D73E)
Ref Sequence ENSEMBL: ENSMUSP00000149542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079827] [ENSMUST00000213754]
Predicted Effect probably damaging
Transcript: ENSMUST00000079827
AA Change: D73E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078756
Gene: ENSMUSG00000070380
AA Change: D73E

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.4e-51 PFAM
Pfam:7tm_1 44 293 2.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213754
AA Change: D73E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.5738 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Olfr401
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Olfr401 APN 11 74121879 missense probably benign 0.00
IGL01303:Olfr401 APN 11 74121334 missense probably damaging 1.00
IGL01397:Olfr401 APN 11 74121764 missense probably damaging 0.97
IGL02101:Olfr401 APN 11 74121745 nonsense probably null
IGL02121:Olfr401 APN 11 74121287 splice site probably benign
IGL02347:Olfr401 APN 11 74121571 missense probably benign 0.03
IGL03113:Olfr401 APN 11 74121703 missense probably benign 0.13
IGL03126:Olfr401 APN 11 74121784 missense probably benign 0.01
IGL03302:Olfr401 APN 11 74121633 missense possibly damaging 0.60
R0549:Olfr401 UTSW 11 74121475 missense probably damaging 1.00
R1180:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R1350:Olfr401 UTSW 11 74122213 missense possibly damaging 0.96
R1800:Olfr401 UTSW 11 74121408 missense probably benign 0.00
R1808:Olfr401 UTSW 11 74121431 missense probably damaging 0.96
R1962:Olfr401 UTSW 11 74121824 missense probably benign 0.02
R1998:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R1999:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R2000:Olfr401 UTSW 11 74121580 missense probably benign 0.28
R2859:Olfr401 UTSW 11 74121982 missense probably damaging 1.00
R4914:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4915:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4916:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R4918:Olfr401 UTSW 11 74121879 missense probably benign 0.00
R5292:Olfr401 UTSW 11 74122051 missense probably damaging 0.99
R5522:Olfr401 UTSW 11 74121658 missense probably damaging 1.00
R5761:Olfr401 UTSW 11 74121509 missense probably damaging 0.97
R6318:Olfr401 UTSW 11 74121721 missense possibly damaging 0.82
R6608:Olfr401 UTSW 11 74121628 missense probably benign 0.00
R6737:Olfr401 UTSW 11 74121906 missense probably benign
R6790:Olfr401 UTSW 11 74121601 missense probably damaging 1.00
R7243:Olfr401 UTSW 11 74121733 missense probably damaging 0.97
R7423:Olfr401 UTSW 11 74121985 missense probably benign 0.01
R7833:Olfr401 UTSW 11 74121837 missense probably damaging 1.00
R8241:Olfr401 UTSW 11 74122209 missense probably benign 0.03
R8423:Olfr401 UTSW 11 74121666 missense probably benign 0.06
R8937:Olfr401 UTSW 11 74122048 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAACGGAACCACTGTTACTG -3'
(R):5'- TGAGGCCACCAAAATTCTCTG -3'

Sequencing Primer
(F):5'- CGGAACCACTGTTACTGAATTC -3'
(R):5'- CCAAAATTCTCTGCACTGAATGG -3'
Posted On2019-10-17