Incidental Mutation 'R7517:Ankrd28'
ID582535
Institutional Source Beutler Lab
Gene Symbol Ankrd28
Ensembl Gene ENSMUSG00000014496
Gene Nameankyrin repeat domain 28
SynonymsE430019N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31698768-31830651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31715374 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 578 (V578E)
Ref Sequence ENSEMBL: ENSMUSP00000014640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014640] [ENSMUST00000227089] [ENSMUST00000227863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014640
AA Change: V578E

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014640
Gene: ENSMUSG00000014496
AA Change: V578E

DomainStartEndE-ValueType
ANK 7 36 5.69e2 SMART
ANK 40 69 2.45e-4 SMART
ANK 73 102 1.59e-3 SMART
ANK 106 135 1.09e-1 SMART
ANK 139 168 1.58e-7 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.01e-5 SMART
ANK 238 267 2.74e-7 SMART
ANK 271 301 4.13e-2 SMART
ANK 305 334 3.8e-1 SMART
ANK 338 367 3.06e-5 SMART
ANK 371 400 1.44e-1 SMART
ANK 404 433 6.76e-7 SMART
ANK 437 466 1.73e-4 SMART
ANK 470 500 7.83e-3 SMART
ANK 504 534 2.99e1 SMART
ANK 549 578 1.34e-1 SMART
ANK 582 611 3.76e-5 SMART
ANK 616 645 4.13e-2 SMART
ANK 652 681 1.24e-5 SMART
ANK 685 714 4.5e-3 SMART
ANK 718 747 1.93e-2 SMART
ANK 755 784 2.85e-5 SMART
ANK 787 818 2.15e0 SMART
ANK 822 851 2.16e-5 SMART
ANK 855 885 4.5e-3 SMART
ANK 889 918 6.61e-1 SMART
ANK 925 954 3.85e-2 SMART
low complexity region 982 995 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000227089
AA Change: V424E

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227863
AA Change: V608E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Ankrd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ankrd28 APN 14 31743365 missense possibly damaging 0.94
IGL01335:Ankrd28 APN 14 31702024 missense probably damaging 0.99
IGL01564:Ankrd28 APN 14 31755767 missense probably damaging 1.00
IGL01624:Ankrd28 APN 14 31710857 missense probably benign 0.00
IGL01987:Ankrd28 APN 14 31778974 missense probably damaging 1.00
IGL02100:Ankrd28 APN 14 31727625 unclassified probably benign
IGL02307:Ankrd28 APN 14 31733708 missense probably damaging 1.00
IGL02656:Ankrd28 APN 14 31702240 missense possibly damaging 0.94
IGL03069:Ankrd28 APN 14 31755786 nonsense probably null
G1citation:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0124:Ankrd28 UTSW 14 31727741 missense probably damaging 1.00
R0347:Ankrd28 UTSW 14 31702022 makesense probably null
R0452:Ankrd28 UTSW 14 31748738 missense probably damaging 1.00
R0685:Ankrd28 UTSW 14 31743450 unclassified probably benign
R0751:Ankrd28 UTSW 14 31764268 missense probably damaging 1.00
R1349:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1372:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1695:Ankrd28 UTSW 14 31707244 missense probably damaging 1.00
R1888:Ankrd28 UTSW 14 31732025 splice site probably benign
R1938:Ankrd28 UTSW 14 31705276 missense possibly damaging 0.74
R2001:Ankrd28 UTSW 14 31745336 missense possibly damaging 0.94
R2162:Ankrd28 UTSW 14 31708762 missense probably damaging 1.00
R2352:Ankrd28 UTSW 14 31710947 missense probably benign 0.05
R2357:Ankrd28 UTSW 14 31764294 nonsense probably null
R3545:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3548:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3710:Ankrd28 UTSW 14 31748851 splice site probably benign
R4282:Ankrd28 UTSW 14 31745225 missense possibly damaging 0.74
R4501:Ankrd28 UTSW 14 31706796 missense probably damaging 0.97
R4513:Ankrd28 UTSW 14 31743285 missense probably damaging 1.00
R4658:Ankrd28 UTSW 14 31710868 missense probably damaging 1.00
R4731:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4732:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4733:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4776:Ankrd28 UTSW 14 31732054 missense probably damaging 1.00
R4801:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R4802:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R5279:Ankrd28 UTSW 14 31735006 missense probably damaging 0.99
R5633:Ankrd28 UTSW 14 31735065 missense probably damaging 1.00
R5809:Ankrd28 UTSW 14 31743354 missense probably benign 0.19
R5959:Ankrd28 UTSW 14 31729922 missense probably benign 0.16
R6228:Ankrd28 UTSW 14 31707220 missense probably damaging 1.00
R6358:Ankrd28 UTSW 14 31710864 missense probably damaging 1.00
R6533:Ankrd28 UTSW 14 31732084 missense possibly damaging 0.49
R6598:Ankrd28 UTSW 14 31708939 missense probably damaging 1.00
R6822:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R7352:Ankrd28 UTSW 14 31708041 missense probably damaging 1.00
R7396:Ankrd28 UTSW 14 31702202 missense probably benign 0.00
R7462:Ankrd28 UTSW 14 31778929 missense probably benign 0.40
R7629:Ankrd28 UTSW 14 31715264 missense probably benign 0.00
R7783:Ankrd28 UTSW 14 31706813 missense probably damaging 0.99
R7981:Ankrd28 UTSW 14 31702157 missense probably benign 0.08
R8401:Ankrd28 UTSW 14 31745294 missense probably damaging 1.00
R8483:Ankrd28 UTSW 14 31735091 splice site probably null
R8752:Ankrd28 UTSW 14 31755742 start gained probably benign
R8946:Ankrd28 UTSW 14 31708126 missense probably damaging 1.00
R8963:Ankrd28 UTSW 14 31755741 missense probably benign 0.06
RF010:Ankrd28 UTSW 14 31778986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCAGGAGCAGTACTAAAAGAAT -3'
(R):5'- TGCAGTAGGGTAGTGGACAT -3'

Sequencing Primer
(F):5'- GCATGGATAGGTGTTCTCT -3'
(R):5'- GTAGTGGACATGTAACTCTAGTAGAC -3'
Posted On2019-10-17