Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Mpp7'

582540

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 7440183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 263 (Q263*)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000115869
AA Change: Q263*

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: Q263*

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGATTCACAGGCAGGGTTTG -3'
(R):5'- TACCAGAGTCAGTCCAAGGG -3'

Sequencing Primer
(F):5'- TGTCATAACTGCTAGAGTGATCTTC -3'
(R):5'- TCAGTCCAAGGGAGCAATTAC -3'

Posted On

2019-10-17