Incidental Mutation 'R7517:Mpp7'
ID582540
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Namemembrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location7347962-7626863 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 7440183 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 263 (Q263*)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
Predicted Effect probably null
Transcript: ENSMUST00000115869
AA Change: Q263*
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: Q263*

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7353297 missense probably benign 0.00
IGL01575:Mpp7 APN 18 7403365 splice site probably benign
IGL02973:Mpp7 APN 18 7403297 missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7461637 critical splice donor site probably null
IGL03224:Mpp7 APN 18 7403269 missense probably benign 0.28
IGL03248:Mpp7 APN 18 7403269 missense probably benign 0.28
R0040:Mpp7 UTSW 18 7403180 splice site probably benign
R0089:Mpp7 UTSW 18 7439555 splice site probably benign
R1413:Mpp7 UTSW 18 7350977 missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7350984 missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7350967 makesense probably null
R2379:Mpp7 UTSW 18 7403345 nonsense probably null
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7351085 missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7444062 missense probably benign 0.23
R4574:Mpp7 UTSW 18 7353228 missense probably benign 0.02
R4772:Mpp7 UTSW 18 7379983 splice site probably null
R5066:Mpp7 UTSW 18 7513002 missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7458930 critical splice donor site probably null
R5451:Mpp7 UTSW 18 7442855 missense probably null 0.95
R5578:Mpp7 UTSW 18 7355101 missense probably benign
R5651:Mpp7 UTSW 18 7355016 critical splice donor site probably null
R5787:Mpp7 UTSW 18 7461682 missense probably benign
R6979:Mpp7 UTSW 18 7355049 missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7441623 missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7351079 missense probably damaging 0.98
R8278:Mpp7 UTSW 18 7444025 missense probably benign
R8373:Mpp7 UTSW 18 7444096 missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7440430 critical splice donor site probably null
X0028:Mpp7 UTSW 18 7403273 missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7355062 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATTCACAGGCAGGGTTTG -3'
(R):5'- TACCAGAGTCAGTCCAAGGG -3'

Sequencing Primer
(F):5'- TGTCATAACTGCTAGAGTGATCTTC -3'
(R):5'- TCAGTCCAAGGGAGCAATTAC -3'
Posted On2019-10-17