Incidental Mutation 'R7517:Mpp7'
ID 582540
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 5430426E14Rik, 1110068J02Rik
MMRRC Submission 045590-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R7517 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 7347959-7626866 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 7440183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 263 (Q263*)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000115869
AA Change: Q263*
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: Q263*

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,437,331 (GRCm39) V578E possibly damaging Het
Arhgap35 A T 7: 16,296,132 (GRCm39) C978S probably benign Het
Asph A T 4: 9,517,697 (GRCm39) V475E probably damaging Het
Atf7ip2 T A 16: 10,059,399 (GRCm39) probably null Het
Bace1 A T 9: 45,771,559 (GRCm39) D491V probably benign Het
Birc2 A G 9: 7,819,424 (GRCm39) I496T probably benign Het
Cacna2d4 C T 6: 119,248,882 (GRCm39) R448C probably benign Het
Ccdc181 T C 1: 164,107,989 (GRCm39) F224S probably damaging Het
Cdan1 C T 2: 120,558,405 (GRCm39) R469Q probably damaging Het
Ddx21 G A 10: 62,424,569 (GRCm39) P544L probably damaging Het
Epas1 C A 17: 87,138,526 (GRCm39) T874N possibly damaging Het
Fam13b A T 18: 34,627,660 (GRCm39) D180E probably damaging Het
Fcgbp G A 7: 27,784,794 (GRCm39) V285M probably damaging Het
Gcn1 T G 5: 115,757,755 (GRCm39) L2487V probably benign Het
Gm19410 C T 8: 36,240,772 (GRCm39) A216V possibly damaging Het
Gm4871 G T 5: 144,969,430 (GRCm39) R30S probably damaging Het
Gtf2ird1 T C 5: 134,391,379 (GRCm39) D899G probably benign Het
Hipk3 T C 2: 104,265,059 (GRCm39) T674A probably benign Het
Hnrnph3 A G 10: 62,854,674 (GRCm39) L39S unknown Het
Ift122 T C 6: 115,867,543 (GRCm39) V431A probably benign Het
Il36b A G 2: 24,049,890 (GRCm39) H167R probably benign Het
Lce3e T A 3: 92,875,142 (GRCm39) C33S unknown Het
Lrrc26 T C 2: 25,180,545 (GRCm39) I182T probably benign Het
Magi1 T C 6: 93,685,189 (GRCm39) R730G probably damaging Het
Meis3 G T 7: 15,911,743 (GRCm39) V102F probably damaging Het
Myo7b A T 18: 32,146,320 (GRCm39) I155N probably damaging Het
Nrip1 A T 16: 76,088,072 (GRCm39) *1162K probably null Het
Or3a1b T A 11: 74,012,335 (GRCm39) D73E probably damaging Het
Or4k50-ps1 T C 2: 111,522,444 (GRCm39) F194L unknown Het
Or8i2 A C 2: 86,852,486 (GRCm39) V134G probably benign Het
Pdik1l T A 4: 134,005,736 (GRCm39) E326V possibly damaging Het
Phrf1 T C 7: 140,836,523 (GRCm39) M265T unknown Het
Piezo2 A T 18: 63,215,996 (GRCm39) N1222K possibly damaging Het
Pkd1 G A 17: 24,799,393 (GRCm39) V2871M probably damaging Het
Pon2 T G 6: 5,268,997 (GRCm39) N226H possibly damaging Het
Rftn2 G T 1: 55,234,708 (GRCm39) D338E probably damaging Het
Rnf123 A T 9: 107,947,473 (GRCm39) Y171* probably null Het
Ror2 A T 13: 53,264,901 (GRCm39) N730K possibly damaging Het
Serpinb6c T A 13: 34,079,278 (GRCm39) N138I probably damaging Het
Smco1 A T 16: 32,092,785 (GRCm39) H152L possibly damaging Het
Tgm3 T G 2: 129,883,684 (GRCm39) S447R probably benign Het
Topbp1 A G 9: 103,209,932 (GRCm39) K860E possibly damaging Het
Uba7 C A 9: 107,853,897 (GRCm39) probably benign Het
Ucp3 A G 7: 100,131,089 (GRCm39) N181D probably damaging Het
Unc13b C A 4: 43,215,765 (GRCm39) S21R probably benign Het
Usp34 T A 11: 23,396,968 (GRCm39) S2395R Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7,353,297 (GRCm39) missense probably benign 0.00
IGL01575:Mpp7 APN 18 7,403,365 (GRCm39) splice site probably benign
IGL02973:Mpp7 APN 18 7,403,297 (GRCm39) missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7,461,637 (GRCm39) critical splice donor site probably null
IGL03224:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
IGL03248:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
R0040:Mpp7 UTSW 18 7,403,180 (GRCm39) splice site probably benign
R0089:Mpp7 UTSW 18 7,439,555 (GRCm39) splice site probably benign
R1413:Mpp7 UTSW 18 7,350,977 (GRCm39) missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7,350,984 (GRCm39) missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7,350,967 (GRCm39) makesense probably null
R2379:Mpp7 UTSW 18 7,403,345 (GRCm39) nonsense probably null
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7,351,085 (GRCm39) missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7,444,062 (GRCm39) missense probably benign 0.23
R4574:Mpp7 UTSW 18 7,353,228 (GRCm39) missense probably benign 0.02
R4772:Mpp7 UTSW 18 7,379,983 (GRCm39) splice site probably null
R5066:Mpp7 UTSW 18 7,513,002 (GRCm39) missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7,458,930 (GRCm39) critical splice donor site probably null
R5451:Mpp7 UTSW 18 7,442,855 (GRCm39) missense probably null 0.95
R5578:Mpp7 UTSW 18 7,355,101 (GRCm39) missense probably benign
R5651:Mpp7 UTSW 18 7,355,016 (GRCm39) critical splice donor site probably null
R5787:Mpp7 UTSW 18 7,461,682 (GRCm39) missense probably benign
R6979:Mpp7 UTSW 18 7,355,049 (GRCm39) missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7,441,623 (GRCm39) missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7,351,079 (GRCm39) missense probably damaging 0.98
R8278:Mpp7 UTSW 18 7,444,025 (GRCm39) missense probably benign
R8373:Mpp7 UTSW 18 7,444,096 (GRCm39) missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7,440,430 (GRCm39) critical splice donor site probably null
R9206:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9208:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9439:Mpp7 UTSW 18 7,461,692 (GRCm39) nonsense probably null
R9790:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
R9791:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
X0028:Mpp7 UTSW 18 7,403,273 (GRCm39) missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7,355,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATTCACAGGCAGGGTTTG -3'
(R):5'- TACCAGAGTCAGTCCAAGGG -3'

Sequencing Primer
(F):5'- TGTCATAACTGCTAGAGTGATCTTC -3'
(R):5'- TCAGTCCAAGGGAGCAATTAC -3'
Posted On 2019-10-17