Incidental Mutation 'R7517:Fam13b'
ID582542
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Namefamily with sequence similarity 13, member B
Synonyms2610024E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34442352-34506823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34494607 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 180 (D180E)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
Predicted Effect probably damaging
Transcript: ENSMUST00000040506
AA Change: D180E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: D180E

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTAATTTGTACCCTGAACACAGC -3'
(R):5'- TGAGCCTGGCAAAATATCTGAGC -3'

Sequencing Primer
(F):5'- TGAACACAGCAATGCTCTGAG -3'
(R):5'- GCCTGGCAAAATATCTGAGCTTTAC -3'
Posted On2019-10-17