Mutagenetix > Incidental Mutation

Incidental Mutation 'R7519:Ubr1'

582550

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

045591-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R7519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120875444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1513 (I1513F)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028728
AA Change: I1513F

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: I1513F

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Meta Mutation Damage Score

0.3273

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	G	A	7: 27,574,730 (GRCm38)	R132K		Het
Acaca	T	C	11: 84,245,856 (GRCm38)	S571P	probably damaging	Het
Adamts20	T	G	15: 94,325,988 (GRCm38)	K1286N	possibly damaging	Het
Adamts7	A	G	9: 90,197,079 (GRCm38)	D1477G	probably benign	Het
Alox12b	C	T	11: 69,163,213 (GRCm38)	T207I	probably benign	Het
Arid1b	CGGCGG	CGGCGGTGGCGG	17: 4,995,853 (GRCm38)		probably benign	Het
Arid1b	GGGCGGCGGCGGCGGCGGCGGCGG	GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG	17: 4,995,844 (GRCm38)		probably benign	Het
Aspm	T	A	1: 139,490,336 (GRCm38)	N2934K	possibly damaging	Het
Axin2	T	G	11: 108,942,246 (GRCm38)	V419G	probably benign	Het
B4galnt4	A	G	7: 141,064,344 (GRCm38)	T108A	probably damaging	Het
Cacna1s	G	A	1: 136,070,756 (GRCm38)	R174Q	probably damaging	Het
Cdh18	G	T	15: 23,474,212 (GRCm38)	A723S	possibly damaging	Het
Ces4a	T	C	8: 105,145,219 (GRCm38)	M307T	probably damaging	Het
Cobl	T	A	11: 12,253,124 (GRCm38)	I1193F	probably damaging	Het
Crb2	G	T	2: 37,793,320 (GRCm38)	G945W	probably damaging	Het
Ctnna1	T	G	18: 35,174,371 (GRCm38)	I140M	probably benign	Het
Dnah5	T	C	15: 28,390,483 (GRCm38)	S3213P	probably damaging	Het
Fbln7	A	G	2: 128,893,865 (GRCm38)	S258G	probably benign	Het
Fbxo15	T	G	18: 84,964,234 (GRCm38)		probably benign	Het
Fcgbp	A	G	7: 28,086,299 (GRCm38)	Y387C	probably damaging	Het
Flt3l	G	A	7: 45,133,845 (GRCm38)	T176I	unknown	Het
Galk2	G	A	2: 125,983,252 (GRCm38)	R456H	possibly damaging	Het
Gm10840	T	C	11: 106,160,890 (GRCm38)	L14P	unknown	Het
Gm5591	T	C	7: 38,520,670 (GRCm38)	T260A	possibly damaging	Het
Gm6370	T	A	5: 146,493,828 (GRCm38)	D274E	probably damaging	Het
Grhl2	T	A	15: 37,336,312 (GRCm38)	D484E	probably damaging	Het
Hbp1	A	T	12: 31,933,375 (GRCm38)	V360D	probably damaging	Het
Heatr5b	G	T	17: 78,755,217 (GRCm38)	Q1968K	probably benign	Het
Igsf8	C	T	1: 172,316,307 (GRCm38)	T72M	probably benign	Het
Kera	A	T	10: 97,609,022 (GRCm38)	N81I	probably damaging	Het
Klhl14	C	T	18: 21,651,843 (GRCm38)	V176I	probably benign	Het
Klrb1	A	T	6: 128,712,289 (GRCm38)	V73E	probably damaging	Het
Krtap31-2	T	C	11: 99,936,675 (GRCm38)	L111P	possibly damaging	Het
Mbtd1	T	C	11: 93,908,899 (GRCm38)	S106P	probably damaging	Het
Nckap5l	T	C	15: 99,426,247 (GRCm38)	T792A	probably benign	Het
Ndufaf4	A	C	4: 24,901,847 (GRCm38)	T132P	probably damaging	Het
Neo1	A	G	9: 58,878,065 (GRCm38)	V1453A	probably benign	Het
Olfr1136	T	C	2: 87,693,409 (GRCm38)	I158V	probably benign	Het
Olfr809	A	C	10: 129,776,222 (GRCm38)	I103L	probably benign	Het
Pcdha11	T	A	18: 37,006,266 (GRCm38)	L316*	probably null	Het
Pcdha7	T	C	18: 36,976,232 (GRCm38)	M770T	possibly damaging	Het
Pcsk1	T	C	13: 75,110,865 (GRCm38)	S253P	probably damaging	Het
Phtf1	T	C	3: 103,969,119 (GRCm38)	Y12H	probably damaging	Het
Pkd1l2	T	C	8: 117,065,529 (GRCm38)	N508S	probably benign	Het
Pla1a	A	G	16: 38,414,846 (GRCm38)	I162T	possibly damaging	Het
Rb1	A	T	14: 73,264,608 (GRCm38)	L446M	probably damaging	Het
Retn	A	T	8: 3,656,079 (GRCm38)	S22C	probably damaging	Het
Snx25	A	G	8: 46,116,272 (GRCm38)	L196P	probably damaging	Het
Sp110	G	A	1: 85,579,092 (GRCm38)	R417C	probably benign	Het
Spata31d1b	G	A	13: 59,716,912 (GRCm38)	D625N	probably benign	Het
Sycp2	T	C	2: 178,346,333 (GRCm38)	*1501W	probably null	Het
Tarbp1	T	G	8: 126,433,900 (GRCm38)	T1271P	possibly damaging	Het
Uba1y	T	C	Y: 821,567 (GRCm38)	F154L	probably benign	Het
Vmn2r110	T	A	17: 20,584,262 (GRCm38)	Q132L	probably benign	Het
Vwf	A	T	6: 125,667,543 (GRCm38)	T2454S		Het
Wdr33	C	A	18: 31,896,770 (GRCm38)	F1007L	unknown	Het
Zfp398	A	G	6: 47,859,473 (GRCm38)	H201R	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,875,407 (GRCm38)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,941,093 (GRCm38)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,930,872 (GRCm38)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,914,905 (GRCm38)	missense	probably benign
IGL01346:Ubr1	APN	2	120,873,122 (GRCm38)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,941,131 (GRCm38)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,926,013 (GRCm38)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,934,342 (GRCm38)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,875,398 (GRCm38)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,921,386 (GRCm38)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,900,508 (GRCm38)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,946,349 (GRCm38)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,970,603 (GRCm38)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,864,373 (GRCm38)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,870,979 (GRCm38)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,940,991 (GRCm38)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,914,883 (GRCm38)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,941,091 (GRCm38)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,881,183 (GRCm38)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,961,156 (GRCm38)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,864,417 (GRCm38)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,895,160 (GRCm38)	missense	probably benign
I1329:Ubr1	UTSW	2	120,934,294 (GRCm38)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,961,173 (GRCm38)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,904,103 (GRCm38)	splice site	probably null
R0373:Ubr1	UTSW	2	120,946,657 (GRCm38)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,906,946 (GRCm38)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,881,093 (GRCm38)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,947,883 (GRCm38)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,881,101 (GRCm38)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,926,029 (GRCm38)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,955,644 (GRCm38)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,961,098 (GRCm38)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,935,319 (GRCm38)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,930,968 (GRCm38)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,930,968 (GRCm38)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,946,273 (GRCm38)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,942,553 (GRCm38)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,864,330 (GRCm38)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,926,047 (GRCm38)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,909,482 (GRCm38)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,963,448 (GRCm38)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,916,470 (GRCm38)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,862,687 (GRCm38)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4173:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4174:Ubr1	UTSW	2	120,946,622 (GRCm38)	splice site	probably null
R4241:Ubr1	UTSW	2	120,934,386 (GRCm38)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,970,603 (GRCm38)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,895,066 (GRCm38)	splice site	probably null
R4449:Ubr1	UTSW	2	120,946,381 (GRCm38)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,942,482 (GRCm38)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,926,013 (GRCm38)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,963,442 (GRCm38)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,914,938 (GRCm38)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,963,566 (GRCm38)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,911,997 (GRCm38)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,963,422 (GRCm38)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,882,264 (GRCm38)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,893,170 (GRCm38)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,904,044 (GRCm38)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,963,500 (GRCm38)	missense	probably benign
R5452:Ubr1	UTSW	2	120,868,302 (GRCm38)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,915,407 (GRCm38)	missense	probably benign
R5610:Ubr1	UTSW	2	120,892,112 (GRCm38)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,963,517 (GRCm38)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,961,092 (GRCm38)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,904,005 (GRCm38)	missense	probably benign
R5979:Ubr1	UTSW	2	120,946,382 (GRCm38)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,862,721 (GRCm38)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,893,209 (GRCm38)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,906,895 (GRCm38)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,881,039 (GRCm38)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,915,399 (GRCm38)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,924,130 (GRCm38)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,955,640 (GRCm38)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,896,675 (GRCm38)	splice site	probably null
R6994:Ubr1	UTSW	2	120,963,593 (GRCm38)	missense	probably benign
R7121:Ubr1	UTSW	2	120,875,498 (GRCm38)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,904,077 (GRCm38)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,862,765 (GRCm38)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,862,680 (GRCm38)	missense	probably benign
R7457:Ubr1	UTSW	2	120,917,828 (GRCm38)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,889,774 (GRCm38)	critical splice donor site	probably null
R7574:Ubr1	UTSW	2	120,873,191 (GRCm38)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,934,374 (GRCm38)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,934,417 (GRCm38)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,961,104 (GRCm38)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,963,456 (GRCm38)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,911,115 (GRCm38)	missense	probably benign
R8293:Ubr1	UTSW	2	120,862,721 (GRCm38)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,870,995 (GRCm38)	missense	probably benign
R8489:Ubr1	UTSW	2	120,881,067 (GRCm38)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,866,483 (GRCm38)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,904,042 (GRCm38)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,866,553 (GRCm38)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,925,988 (GRCm38)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,924,134 (GRCm38)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,873,122 (GRCm38)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,947,844 (GRCm38)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,896,519 (GRCm38)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,935,284 (GRCm38)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,904,025 (GRCm38)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,873,146 (GRCm38)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,934,339 (GRCm38)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,901,611 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCATGAACACAGACGATG -3'
(R):5'- CCTAGTGCTGAGGGCTTTAG -3'

Sequencing Primer
(F):5'- CACAGACGATGGGTAGGGC -3'
(R):5'- TCAGGTGGACATAAAAACTATTGGC -3'

Posted On

2019-10-17