Incidental Mutation 'R7519:Ubr1'
ID582550
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R7519 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120875444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1513 (I1513F)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028728
AA Change: I1513F

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: I1513F

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,730 R132K Het
Acaca T C 11: 84,245,856 S571P probably damaging Het
Adamts20 T G 15: 94,325,988 K1286N possibly damaging Het
Adamts7 A G 9: 90,197,079 D1477G probably benign Het
Alox12b C T 11: 69,163,213 T207I probably benign Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b CGGCGG CGGCGGTGGCGG 17: 4,995,853 probably benign Het
Aspm T A 1: 139,490,336 N2934K possibly damaging Het
Axin2 T G 11: 108,942,246 V419G probably benign Het
B4galnt4 A G 7: 141,064,344 T108A probably damaging Het
Cacna1s G A 1: 136,070,756 R174Q probably damaging Het
Cdh18 G T 15: 23,474,212 A723S possibly damaging Het
Ces4a T C 8: 105,145,219 M307T probably damaging Het
Cobl T A 11: 12,253,124 I1193F probably damaging Het
Crb2 G T 2: 37,793,320 G945W probably damaging Het
Ctnna1 T G 18: 35,174,371 I140M probably benign Het
Dnah5 T C 15: 28,390,483 S3213P probably damaging Het
Fbln7 A G 2: 128,893,865 S258G probably benign Het
Fcgbp A G 7: 28,086,299 Y387C probably damaging Het
Flt3l G A 7: 45,133,845 T176I unknown Het
Galk2 G A 2: 125,983,252 R456H possibly damaging Het
Gm10840 T C 11: 106,160,890 L14P unknown Het
Gm5591 T C 7: 38,520,670 T260A possibly damaging Het
Gm6370 T A 5: 146,493,828 D274E probably damaging Het
Grhl2 T A 15: 37,336,312 D484E probably damaging Het
Hbp1 A T 12: 31,933,375 V360D probably damaging Het
Heatr5b G T 17: 78,755,217 Q1968K probably benign Het
Igsf8 C T 1: 172,316,307 T72M probably benign Het
Kera A T 10: 97,609,022 N81I probably damaging Het
Klhl14 C T 18: 21,651,843 V176I probably benign Het
Klrb1 A T 6: 128,712,289 V73E probably damaging Het
Krtap31-2 T C 11: 99,936,675 L111P possibly damaging Het
Mbtd1 T C 11: 93,908,899 S106P probably damaging Het
Nckap5l T C 15: 99,426,247 T792A probably benign Het
Ndufaf4 A C 4: 24,901,847 T132P probably damaging Het
Neo1 A G 9: 58,878,065 V1453A probably benign Het
Olfr1136 T C 2: 87,693,409 I158V probably benign Het
Olfr809 A C 10: 129,776,222 I103L probably benign Het
Pcdha11 T A 18: 37,006,266 L316* probably null Het
Pcdha7 T C 18: 36,976,232 M770T possibly damaging Het
Pcsk1 T C 13: 75,110,865 S253P probably damaging Het
Phtf1 T C 3: 103,969,119 Y12H probably damaging Het
Pkd1l2 T C 8: 117,065,529 N508S probably benign Het
Pla1a A G 16: 38,414,846 I162T possibly damaging Het
Rb1 A T 14: 73,264,608 L446M probably damaging Het
Retn A T 8: 3,656,079 S22C probably damaging Het
Snx25 A G 8: 46,116,272 L196P probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spata31d1b G A 13: 59,716,912 D625N probably benign Het
Sycp2 T C 2: 178,346,333 *1501W probably null Het
Tarbp1 T G 8: 126,433,900 T1271P possibly damaging Het
Tro CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCAGTTTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA X: 150,654,520 probably benign Het
Uba1y T C Y: 821,567 F154L probably benign Het
Vmn2r110 T A 17: 20,584,262 Q132L probably benign Het
Vwf A T 6: 125,667,543 T2454S Het
Wdr33 C A 18: 31,896,770 F1007L unknown Het
Zfp398 A G 6: 47,859,473 H201R probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 synonymous probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 intron probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGCATGAACACAGACGATG -3'
(R):5'- CCTAGTGCTGAGGGCTTTAG -3'

Sequencing Primer
(F):5'- CACAGACGATGGGTAGGGC -3'
(R):5'- TCAGGTGGACATAAAAACTATTGGC -3'
Posted On2019-10-17