Incidental Mutation 'R7519:Cobl'
ID582574
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7519 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12253124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1193 (I1193F)
Ref Sequence ENSEMBL: ENSMUSP00000045693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
PDB Structure
Actin complex with Gelsolin Segment 1 fused to Cobl segment [X-RAY DIFFRACTION]
Crystal Structure of an Actin Dimer in Complex with the Actin Nucleator Cordon-Bleu [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000046755
AA Change: I1193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: I1193F

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109650
AA Change: I1111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: I1111F

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109651
AA Change: I1168F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: I1168F

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174874
AA Change: I1186F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: I1186F

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,730 R132K Het
Acaca T C 11: 84,245,856 S571P probably damaging Het
Adamts20 T G 15: 94,325,988 K1286N possibly damaging Het
Adamts7 A G 9: 90,197,079 D1477G probably benign Het
Alox12b C T 11: 69,163,213 T207I probably benign Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b CGGCGG CGGCGGTGGCGG 17: 4,995,853 probably benign Het
Aspm T A 1: 139,490,336 N2934K possibly damaging Het
Axin2 T G 11: 108,942,246 V419G probably benign Het
B4galnt4 A G 7: 141,064,344 T108A probably damaging Het
Cacna1s G A 1: 136,070,756 R174Q probably damaging Het
Cdh18 G T 15: 23,474,212 A723S possibly damaging Het
Ces4a T C 8: 105,145,219 M307T probably damaging Het
Crb2 G T 2: 37,793,320 G945W probably damaging Het
Ctnna1 T G 18: 35,174,371 I140M probably benign Het
Dnah5 T C 15: 28,390,483 S3213P probably damaging Het
Fbln7 A G 2: 128,893,865 S258G probably benign Het
Fcgbp A G 7: 28,086,299 Y387C probably damaging Het
Flt3l G A 7: 45,133,845 T176I unknown Het
Galk2 G A 2: 125,983,252 R456H possibly damaging Het
Gm10840 T C 11: 106,160,890 L14P unknown Het
Gm5591 T C 7: 38,520,670 T260A possibly damaging Het
Gm6370 T A 5: 146,493,828 D274E probably damaging Het
Grhl2 T A 15: 37,336,312 D484E probably damaging Het
Hbp1 A T 12: 31,933,375 V360D probably damaging Het
Heatr5b G T 17: 78,755,217 Q1968K probably benign Het
Igsf8 C T 1: 172,316,307 T72M probably benign Het
Kera A T 10: 97,609,022 N81I probably damaging Het
Klhl14 C T 18: 21,651,843 V176I probably benign Het
Klrb1 A T 6: 128,712,289 V73E probably damaging Het
Krtap31-2 T C 11: 99,936,675 L111P possibly damaging Het
Mbtd1 T C 11: 93,908,899 S106P probably damaging Het
Nckap5l T C 15: 99,426,247 T792A probably benign Het
Ndufaf4 A C 4: 24,901,847 T132P probably damaging Het
Neo1 A G 9: 58,878,065 V1453A probably benign Het
Olfr1136 T C 2: 87,693,409 I158V probably benign Het
Olfr809 A C 10: 129,776,222 I103L probably benign Het
Pcdha11 T A 18: 37,006,266 L316* probably null Het
Pcdha7 T C 18: 36,976,232 M770T possibly damaging Het
Pcsk1 T C 13: 75,110,865 S253P probably damaging Het
Phtf1 T C 3: 103,969,119 Y12H probably damaging Het
Pkd1l2 T C 8: 117,065,529 N508S probably benign Het
Pla1a A G 16: 38,414,846 I162T possibly damaging Het
Rb1 A T 14: 73,264,608 L446M probably damaging Het
Retn A T 8: 3,656,079 S22C probably damaging Het
Snx25 A G 8: 46,116,272 L196P probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spata31d1b G A 13: 59,716,912 D625N probably benign Het
Sycp2 T C 2: 178,346,333 *1501W probably null Het
Tarbp1 T G 8: 126,433,900 T1271P possibly damaging Het
Tro CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCAGTTTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA X: 150,654,520 probably benign Het
Uba1y T C Y: 821,567 F154L probably benign Het
Ubr1 T A 2: 120,875,444 I1513F possibly damaging Het
Vmn2r110 T A 17: 20,584,262 Q132L probably benign Het
Vwf A T 6: 125,667,543 T2454S Het
Wdr33 C A 18: 31,896,770 F1007L unknown Het
Zfp398 A G 6: 47,859,473 H201R probably benign Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
R7841:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7845:Cobl UTSW 11 12365139 missense probably benign 0.35
R7924:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7928:Cobl UTSW 11 12365139 missense probably benign 0.35
R8026:Cobl UTSW 11 12253459 missense not run
Z1176:Cobl UTSW 11 12253433 missense not run
Z1176:Cobl UTSW 11 12369645 missense not run
Z1176:Cobl UTSW 11 12375827 missense not run
Predicted Primers PCR Primer
(F):5'- CAATCATCAGCCTCTCTAGTGTTG -3'
(R):5'- AACCCCAGGAAATTGTGAGC -3'

Sequencing Primer
(F):5'- CTCTCTAGTGTTGTTATTCGAATGC -3'
(R):5'- AATCCACCCTGACTAGCTATATTATC -3'
Posted On2019-10-17