Incidental Mutation 'R7519:Acaca'
ID582576
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7519 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84245856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 571 (S571P)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: S571P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: S571P

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: S571P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: S571P

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Meta Mutation Damage Score 0.3300 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,730 R132K Het
Adamts20 T G 15: 94,325,988 K1286N possibly damaging Het
Adamts7 A G 9: 90,197,079 D1477G probably benign Het
Alox12b C T 11: 69,163,213 T207I probably benign Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b CGGCGG CGGCGGTGGCGG 17: 4,995,853 probably benign Het
Aspm T A 1: 139,490,336 N2934K possibly damaging Het
Axin2 T G 11: 108,942,246 V419G probably benign Het
B4galnt4 A G 7: 141,064,344 T108A probably damaging Het
Cacna1s G A 1: 136,070,756 R174Q probably damaging Het
Cdh18 G T 15: 23,474,212 A723S possibly damaging Het
Ces4a T C 8: 105,145,219 M307T probably damaging Het
Cobl T A 11: 12,253,124 I1193F probably damaging Het
Crb2 G T 2: 37,793,320 G945W probably damaging Het
Ctnna1 T G 18: 35,174,371 I140M probably benign Het
Dnah5 T C 15: 28,390,483 S3213P probably damaging Het
Fbln7 A G 2: 128,893,865 S258G probably benign Het
Fbxo15 T G 18: 84,964,234 probably benign Het
Fcgbp A G 7: 28,086,299 Y387C probably damaging Het
Flt3l G A 7: 45,133,845 T176I unknown Het
Galk2 G A 2: 125,983,252 R456H possibly damaging Het
Gm10840 T C 11: 106,160,890 L14P unknown Het
Gm5591 T C 7: 38,520,670 T260A possibly damaging Het
Gm6370 T A 5: 146,493,828 D274E probably damaging Het
Grhl2 T A 15: 37,336,312 D484E probably damaging Het
Hbp1 A T 12: 31,933,375 V360D probably damaging Het
Heatr5b G T 17: 78,755,217 Q1968K probably benign Het
Igsf8 C T 1: 172,316,307 T72M probably benign Het
Kera A T 10: 97,609,022 N81I probably damaging Het
Klhl14 C T 18: 21,651,843 V176I probably benign Het
Klrb1 A T 6: 128,712,289 V73E probably damaging Het
Krtap31-2 T C 11: 99,936,675 L111P possibly damaging Het
Mbtd1 T C 11: 93,908,899 S106P probably damaging Het
Nckap5l T C 15: 99,426,247 T792A probably benign Het
Ndufaf4 A C 4: 24,901,847 T132P probably damaging Het
Neo1 A G 9: 58,878,065 V1453A probably benign Het
Olfr1136 T C 2: 87,693,409 I158V probably benign Het
Olfr809 A C 10: 129,776,222 I103L probably benign Het
Pcdha11 T A 18: 37,006,266 L316* probably null Het
Pcdha7 T C 18: 36,976,232 M770T possibly damaging Het
Pcsk1 T C 13: 75,110,865 S253P probably damaging Het
Phtf1 T C 3: 103,969,119 Y12H probably damaging Het
Pkd1l2 T C 8: 117,065,529 N508S probably benign Het
Pla1a A G 16: 38,414,846 I162T possibly damaging Het
Rb1 A T 14: 73,264,608 L446M probably damaging Het
Retn A T 8: 3,656,079 S22C probably damaging Het
Snx25 A G 8: 46,116,272 L196P probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spata31d1b G A 13: 59,716,912 D625N probably benign Het
Sycp2 T C 2: 178,346,333 *1501W probably null Het
Tarbp1 T G 8: 126,433,900 T1271P possibly damaging Het
Uba1y T C Y: 821,567 F154L probably benign Het
Ubr1 T A 2: 120,875,444 I1513F possibly damaging Het
Vmn2r110 T A 17: 20,584,262 Q132L probably benign Het
Vwf A T 6: 125,667,543 T2454S Het
Wdr33 C A 18: 31,896,770 F1007L unknown Het
Zfp398 A G 6: 47,859,473 H201R probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
greenhouse UTSW 11 84338356 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7950:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7981:Acaca UTSW 11 84364449 critical splice donor site probably null
R7990:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTAACAGGGGTTTAAGCC -3'
(R):5'- TGGGCAAGAATCTACCTCTCC -3'

Sequencing Primer
(F):5'- AGCTCTGGAACAGTTCAG -3'
(R):5'- ACTTTTGGGATAGCAATGGAAATG -3'
Posted On2019-10-17