Mutagenetix > Incidental Mutation

Incidental Mutation 'R7519:Pcsk1'

582583

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75110865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 253 (S253P)

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022075
AA Change: S253P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: S253P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000222727
AA Change: S16P

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	G	A	7: 27,574,730	R132K		Het
Acaca	T	C	11: 84,245,856	S571P	probably damaging	Het
Adamts20	T	G	15: 94,325,988	K1286N	possibly damaging	Het
Adamts7	A	G	9: 90,197,079	D1477G	probably benign	Het
Alox12b	C	T	11: 69,163,213	T207I	probably benign	Het
Arid1b	GGGCGGCGGCGGCGGCGGCGGCGG	GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG	17: 4,995,844		probably benign	Het
Arid1b	CGGCGG	CGGCGGTGGCGG	17: 4,995,853		probably benign	Het
Aspm	T	A	1: 139,490,336	N2934K	possibly damaging	Het
Axin2	T	G	11: 108,942,246	V419G	probably benign	Het
B4galnt4	A	G	7: 141,064,344	T108A	probably damaging	Het
Cacna1s	G	A	1: 136,070,756	R174Q	probably damaging	Het
Cdh18	G	T	15: 23,474,212	A723S	possibly damaging	Het
Ces4a	T	C	8: 105,145,219	M307T	probably damaging	Het
Cobl	T	A	11: 12,253,124	I1193F	probably damaging	Het
Crb2	G	T	2: 37,793,320	G945W	probably damaging	Het
Ctnna1	T	G	18: 35,174,371	I140M	probably benign	Het
Dnah5	T	C	15: 28,390,483	S3213P	probably damaging	Het
Fbln7	A	G	2: 128,893,865	S258G	probably benign	Het
Fbxo15	T	G	18: 84,964,234		probably benign	Het
Fcgbp	A	G	7: 28,086,299	Y387C	probably damaging	Het
Flt3l	G	A	7: 45,133,845	T176I	unknown	Het
Galk2	G	A	2: 125,983,252	R456H	possibly damaging	Het
Gm10840	T	C	11: 106,160,890	L14P	unknown	Het
Gm5591	T	C	7: 38,520,670	T260A	possibly damaging	Het
Gm6370	T	A	5: 146,493,828	D274E	probably damaging	Het
Grhl2	T	A	15: 37,336,312	D484E	probably damaging	Het
Hbp1	A	T	12: 31,933,375	V360D	probably damaging	Het
Heatr5b	G	T	17: 78,755,217	Q1968K	probably benign	Het
Igsf8	C	T	1: 172,316,307	T72M	probably benign	Het
Kera	A	T	10: 97,609,022	N81I	probably damaging	Het
Klhl14	C	T	18: 21,651,843	V176I	probably benign	Het
Klrb1	A	T	6: 128,712,289	V73E	probably damaging	Het
Krtap31-2	T	C	11: 99,936,675	L111P	possibly damaging	Het
Mbtd1	T	C	11: 93,908,899	S106P	probably damaging	Het
Nckap5l	T	C	15: 99,426,247	T792A	probably benign	Het
Ndufaf4	A	C	4: 24,901,847	T132P	probably damaging	Het
Neo1	A	G	9: 58,878,065	V1453A	probably benign	Het
Olfr1136	T	C	2: 87,693,409	I158V	probably benign	Het
Olfr809	A	C	10: 129,776,222	I103L	probably benign	Het
Pcdha11	T	A	18: 37,006,266	L316*	probably null	Het
Pcdha7	T	C	18: 36,976,232	M770T	possibly damaging	Het
Phtf1	T	C	3: 103,969,119	Y12H	probably damaging	Het
Pkd1l2	T	C	8: 117,065,529	N508S	probably benign	Het
Pla1a	A	G	16: 38,414,846	I162T	possibly damaging	Het
Rb1	A	T	14: 73,264,608	L446M	probably damaging	Het
Retn	A	T	8: 3,656,079	S22C	probably damaging	Het
Snx25	A	G	8: 46,116,272	L196P	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Spata31d1b	G	A	13: 59,716,912	D625N	probably benign	Het
Sycp2	T	C	2: 178,346,333	*1501W	probably null	Het
Tarbp1	T	G	8: 126,433,900	T1271P	possibly damaging	Het
Uba1y	T	C	Y: 821,567	F154L	probably benign	Het
Ubr1	T	A	2: 120,875,444	I1513F	possibly damaging	Het
Vmn2r110	T	A	17: 20,584,262	Q132L	probably benign	Het
Vwf	A	T	6: 125,667,543	T2454S		Het
Wdr33	C	A	18: 31,896,770	F1007L	unknown	Het
Zfp398	A	G	6: 47,859,473	H201R	probably benign	Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1199:Pcsk1	UTSW	13	75096413	splice site	probably benign
R1517:Pcsk1	UTSW	13	75098047	nonsense	probably null
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7258:Pcsk1	UTSW	13	75093186	missense	probably damaging	1.00
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R8489:Pcsk1	UTSW	13	75126002	missense	probably damaging	1.00
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9706:Pcsk1	UTSW	13	75099354	critical splice donor site	probably null
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAACCAGTGACTACTTTGGG -3'
(R):5'- TAACATAAGTGTTCTCCCCGCC -3'

Sequencing Primer
(F):5'- ACCAGTGACTACTTTGGGTATTTTTG -3'
(R):5'- CGCCTCATTGTTTCATGTGAG -3'

Posted On

2019-10-17