Incidental Mutation 'R7520:Erich3'
ID582615
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7520 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154763126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1072 (T1072A)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
Predicted Effect unknown
Transcript: ENSMUST00000098496
AA Change: T1072A
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: T1072A

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,114 I886N probably benign Het
Adamts6 A G 13: 104,297,186 H41R probably benign Het
Adck1 T C 12: 88,459,205 probably null Het
Atat1 G T 17: 35,897,814 T398K probably benign Het
Bahcc1 A G 11: 120,276,205 E1144G possibly damaging Het
Cand2 G T 6: 115,785,251 E213* probably null Het
Cep350 A G 1: 155,915,629 S1250P probably benign Het
Cln3 A G 7: 126,581,680 L63P probably damaging Het
Col4a4 A T 1: 82,507,087 C486* probably null Het
Ctnnal1 A T 4: 56,837,838 M264K probably damaging Het
Ddr2 T A 1: 169,984,439 D738V probably damaging Het
Dnah6 T C 6: 73,127,904 M1901V probably benign Het
Dnhd1 A G 7: 105,696,048 T2200A probably benign Het
Dolk A G 2: 30,284,543 Y497H probably benign Het
Drd5 T C 5: 38,320,852 V396A probably benign Het
Epsti1 A T 14: 77,963,443 probably null Het
Ero1l A T 14: 45,306,575 N57K probably damaging Het
Exph5 T C 9: 53,367,214 probably null Het
Frmd5 C T 2: 121,554,264 probably null Het
Gm13124 T C 4: 144,555,289 Y311C probably damaging Het
H2-Q7 A G 17: 35,442,710 T310A probably benign Het
Hecw2 G T 1: 53,926,056 A537E probably benign Het
Itga4 A T 2: 79,300,989 D567V probably damaging Het
Kcnu1 A T 8: 25,885,340 N361Y probably damaging Het
Keap1 A G 9: 21,233,491 S408P probably benign Het
Mamdc4 T A 2: 25,565,348 I928F possibly damaging Het
Mboat4 T C 8: 34,123,874 F155S probably benign Het
Mtbp A G 15: 55,577,346 probably benign Het
Nmi T G 2: 51,952,480 K200T probably benign Het
Olfr138 G A 17: 38,275,440 C223Y probably benign Het
Olfr27 G T 9: 39,144,118 R6L probably benign Het
Pcdha7 G A 18: 36,975,313 V464M probably damaging Het
Peg10 T A 6: 4,756,796 N457K unknown Het
Plekha7 A T 7: 116,137,284 I944N possibly damaging Het
Plpp1 T A 13: 112,801,247 D13E possibly damaging Het
Pnpla6 G T 8: 3,537,508 V1070F probably damaging Het
Riox1 T A 12: 83,951,771 Y360* probably null Het
Sdhb A G 4: 140,966,571 D50G possibly damaging Het
Slc35f2 T A 9: 53,801,101 V126D possibly damaging Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Snap91 T A 9: 86,839,649 I46F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Taar7b T C 10: 24,000,483 L182P probably damaging Het
Tmc1 T A 19: 20,799,178 M606L probably damaging Het
Trpm8 T A 1: 88,343,321 D444E probably benign Het
Tsen54 A G 11: 115,820,971 T405A probably damaging Het
Ttll5 T C 12: 85,899,471 W492R probably damaging Het
Ttn T A 2: 76,897,779 T5566S unknown Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
Zfand1 A G 3: 10,345,949 V115A probably damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
R7751:Erich3 UTSW 3 154763789 missense unknown
R7768:Erich3 UTSW 3 154748331 missense probably benign 0.00
R7955:Erich3 UTSW 3 154739314 nonsense probably null
R8001:Erich3 UTSW 3 154713916 missense probably benign 0.21
R8101:Erich3 UTSW 3 154733513 missense probably damaging 0.99
R8108:Erich3 UTSW 3 154720115 missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154764573 missense unknown
R8310:Erich3 UTSW 3 154704949 missense
Z1176:Erich3 UTSW 3 154698701 missense
Z1176:Erich3 UTSW 3 154762430 missense
Predicted Primers PCR Primer
(F):5'- CTGGCATCAGCAGAACAGTC -3'
(R):5'- ACGACCTCCAGCTCTGTAAG -3'

Sequencing Primer
(F):5'- TGGCATCAGCAGAACAGTCTACAG -3'
(R):5'- AGAGCTTCCTCTTCACCTTGG -3'
Posted On2019-10-17