Incidental Mutation 'R7520:Exph5'
ID582633
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7520 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 53367214 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014] [ENSMUST00000051014] [ENSMUST00000051014]
Predicted Effect probably null
Transcript: ENSMUST00000051014
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051014
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051014
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,114 I886N probably benign Het
Adamts6 A G 13: 104,297,186 H41R probably benign Het
Adck1 T C 12: 88,459,205 probably null Het
Atat1 G T 17: 35,897,814 T398K probably benign Het
Bahcc1 A G 11: 120,276,205 E1144G possibly damaging Het
Cand2 G T 6: 115,785,251 E213* probably null Het
Cep350 A G 1: 155,915,629 S1250P probably benign Het
Cln3 A G 7: 126,581,680 L63P probably damaging Het
Col4a4 A T 1: 82,507,087 C486* probably null Het
Ctnnal1 A T 4: 56,837,838 M264K probably damaging Het
Ddr2 T A 1: 169,984,439 D738V probably damaging Het
Dnah6 T C 6: 73,127,904 M1901V probably benign Het
Dnhd1 A G 7: 105,696,048 T2200A probably benign Het
Dolk A G 2: 30,284,543 Y497H probably benign Het
Drd5 T C 5: 38,320,852 V396A probably benign Het
Epsti1 A T 14: 77,963,443 probably null Het
Erich3 A G 3: 154,763,126 T1072A unknown Het
Ero1l A T 14: 45,306,575 N57K probably damaging Het
Frmd5 C T 2: 121,554,264 probably null Het
Gm13124 T C 4: 144,555,289 Y311C probably damaging Het
H2-Q7 A G 17: 35,442,710 T310A probably benign Het
Hecw2 G T 1: 53,926,056 A537E probably benign Het
Itga4 A T 2: 79,300,989 D567V probably damaging Het
Kcnu1 A T 8: 25,885,340 N361Y probably damaging Het
Keap1 A G 9: 21,233,491 S408P probably benign Het
Mamdc4 T A 2: 25,565,348 I928F possibly damaging Het
Mboat4 T C 8: 34,123,874 F155S probably benign Het
Mtbp A G 15: 55,577,346 probably benign Het
Nmi T G 2: 51,952,480 K200T probably benign Het
Olfr138 G A 17: 38,275,440 C223Y probably benign Het
Olfr27 G T 9: 39,144,118 R6L probably benign Het
Pcdha7 G A 18: 36,975,313 V464M probably damaging Het
Peg10 T A 6: 4,756,796 N457K unknown Het
Plekha7 A T 7: 116,137,284 I944N possibly damaging Het
Plpp1 T A 13: 112,801,247 D13E possibly damaging Het
Pnpla6 G T 8: 3,537,508 V1070F probably damaging Het
Riox1 T A 12: 83,951,771 Y360* probably null Het
Sdhb A G 4: 140,966,571 D50G possibly damaging Het
Slc35f2 T A 9: 53,801,101 V126D possibly damaging Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Snap91 T A 9: 86,839,649 I46F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Taar7b T C 10: 24,000,483 L182P probably damaging Het
Tmc1 T A 19: 20,799,178 M606L probably damaging Het
Trpm8 T A 1: 88,343,321 D444E probably benign Het
Tsen54 A G 11: 115,820,971 T405A probably damaging Het
Ttll5 T C 12: 85,899,471 W492R probably damaging Het
Ttn T A 2: 76,897,779 T5566S unknown Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
Zfand1 A G 3: 10,345,949 V115A probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53375222 missense probably benign 0.04
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R6792:Exph5 UTSW 9 53375317 missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53375722 missense probably benign 0.00
R7521:Exph5 UTSW 9 53374077 missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53375773 missense probably benign 0.41
R7581:Exph5 UTSW 9 53372557 missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53373175 missense possibly damaging 0.62
R8019:Exph5 UTSW 9 53373452 missense probably benign
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53374213 missense probably benign 0.44
Z1177:Exph5 UTSW 9 53377419 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCGCATACTTTAGCTAGAGAAG -3'
(R):5'- AGCCTATACGCCTGTCATTC -3'

Sequencing Primer
(F):5'- CCAGTTGCCAGTGTGTTT -3'
(R):5'- ATACGCCTGTCATTCTTTGATCTCAG -3'
Posted On2019-10-17