Mutagenetix > Incidental Mutations

Incidental Mutation 'R7520:Exph5'

582633

Institutional Source

Beutler Lab

Gene Symbol

Exph5

Ensembl Gene

ENSMUSG00000034584

Gene Name

exophilin 5

Synonyms

Slac2b, AC079869.22gm5, B130009M24Rik, slac2-b

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7520 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53301670-53377514 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 53367214 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000062632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051014] [ENSMUST00000051014] [ENSMUST00000051014]

Predicted Effect

probably null
Transcript: ENSMUST00000051014

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000051014

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000051014

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,078,114	I886N	probably benign	Het
Adamts6	A	G	13: 104,297,186	H41R	probably benign	Het
Adck1	T	C	12: 88,459,205		probably null	Het
Atat1	G	T	17: 35,897,814	T398K	probably benign	Het
Bahcc1	A	G	11: 120,276,205	E1144G	possibly damaging	Het
Cand2	G	T	6: 115,785,251	E213*	probably null	Het
Cep350	A	G	1: 155,915,629	S1250P	probably benign	Het
Cln3	A	G	7: 126,581,680	L63P	probably damaging	Het
Col4a4	A	T	1: 82,507,087	C486*	probably null	Het
Ctnnal1	A	T	4: 56,837,838	M264K	probably damaging	Het
Ddr2	T	A	1: 169,984,439	D738V	probably damaging	Het
Dnah6	T	C	6: 73,127,904	M1901V	probably benign	Het
Dnhd1	A	G	7: 105,696,048	T2200A	probably benign	Het
Dolk	A	G	2: 30,284,543	Y497H	probably benign	Het
Drd5	T	C	5: 38,320,852	V396A	probably benign	Het
Epsti1	A	T	14: 77,963,443		probably null	Het
Erich3	A	G	3: 154,763,126	T1072A	unknown	Het
Ero1l	A	T	14: 45,306,575	N57K	probably damaging	Het
Frmd5	C	T	2: 121,554,264		probably null	Het
Gm13124	T	C	4: 144,555,289	Y311C	probably damaging	Het
H2-Q7	A	G	17: 35,442,710	T310A	probably benign	Het
Hecw2	G	T	1: 53,926,056	A537E	probably benign	Het
Itga4	A	T	2: 79,300,989	D567V	probably damaging	Het
Kcnu1	A	T	8: 25,885,340	N361Y	probably damaging	Het
Keap1	A	G	9: 21,233,491	S408P	probably benign	Het
Mamdc4	T	A	2: 25,565,348	I928F	possibly damaging	Het
Mboat4	T	C	8: 34,123,874	F155S	probably benign	Het
Mtbp	A	G	15: 55,577,346		probably benign	Het
Nmi	T	G	2: 51,952,480	K200T	probably benign	Het
Olfr138	G	A	17: 38,275,440	C223Y	probably benign	Het
Olfr27	G	T	9: 39,144,118	R6L	probably benign	Het
Pcdha7	G	A	18: 36,975,313	V464M	probably damaging	Het
Peg10	T	A	6: 4,756,796	N457K	unknown	Het
Plekha7	A	T	7: 116,137,284	I944N	possibly damaging	Het
Plpp1	T	A	13: 112,801,247	D13E	possibly damaging	Het
Pnpla6	G	T	8: 3,537,508	V1070F	probably damaging	Het
Riox1	T	A	12: 83,951,771	Y360*	probably null	Het
Sdhb	A	G	4: 140,966,571	D50G	possibly damaging	Het
Slc35f2	T	A	9: 53,801,101	V126D	possibly damaging	Het
Slmap	A	G	14: 26,427,420	V612A	probably benign	Het
Snap91	T	A	9: 86,839,649	I46F	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Taar7b	T	C	10: 24,000,483	L182P	probably damaging	Het
Tmc1	T	A	19: 20,799,178	M606L	probably damaging	Het
Trpm8	T	A	1: 88,343,321	D444E	probably benign	Het
Tsen54	A	G	11: 115,820,971	T405A	probably damaging	Het
Ttll5	T	C	12: 85,899,471	W492R	probably damaging	Het
Ttn	T	A	2: 76,897,779	T5566S	unknown	Het
Utp20	A	T	10: 88,818,595	M210K	probably damaging	Het
Zfand1	A	G	3: 10,345,949	V115A	probably damaging	Het

Other mutations in Exph5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Exph5	APN	9	53376706	nonsense	probably null
IGL01387:Exph5	APN	9	53373965	missense	possibly damaging	0.95
IGL01985:Exph5	APN	9	53376569	missense	probably damaging	0.99
IGL02122:Exph5	APN	9	53373674	missense	probably benign	0.05
IGL02156:Exph5	APN	9	53375641	missense	probably damaging	0.96
IGL02192:Exph5	APN	9	53376325	nonsense	probably null
IGL02491:Exph5	APN	9	53375043	missense	possibly damaging	0.89
PIT4802001:Exph5	UTSW	9	53374978	missense	probably damaging	0.96
R0002:Exph5	UTSW	9	53373956	missense	probably damaging	0.99
R0026:Exph5	UTSW	9	53376479	missense	probably benign	0.38
R0086:Exph5	UTSW	9	53337930	missense	possibly damaging	0.90
R0152:Exph5	UTSW	9	53353204	critical splice donor site	probably null
R0369:Exph5	UTSW	9	53373302	missense	probably benign	0.35
R0409:Exph5	UTSW	9	53374343	missense	probably benign	0.00
R0517:Exph5	UTSW	9	53372762	missense	probably benign	0.02
R0658:Exph5	UTSW	9	53377475	missense	unknown
R1606:Exph5	UTSW	9	53374295	missense	probably benign	0.37
R1739:Exph5	UTSW	9	53375588	missense	possibly damaging	0.62
R1769:Exph5	UTSW	9	53373809	missense	probably benign	0.35
R1828:Exph5	UTSW	9	53376641	missense	possibly damaging	0.79
R1862:Exph5	UTSW	9	53376248	missense	probably benign
R1993:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R2012:Exph5	UTSW	9	53367166	missense	possibly damaging	0.49
R2044:Exph5	UTSW	9	53372679	missense	possibly damaging	0.79
R2402:Exph5	UTSW	9	53374925	nonsense	probably null
R3817:Exph5	UTSW	9	53375494	nonsense	probably null
R4771:Exph5	UTSW	9	53373665	missense	possibly damaging	0.95
R4869:Exph5	UTSW	9	53376239	missense	possibly damaging	0.73
R4926:Exph5	UTSW	9	53376625	missense	possibly damaging	0.95
R4996:Exph5	UTSW	9	53375610	missense	possibly damaging	0.79
R5254:Exph5	UTSW	9	53337930	missense	probably damaging	0.99
R5522:Exph5	UTSW	9	53374313	missense	possibly damaging	0.90
R5947:Exph5	UTSW	9	53375222	missense	probably benign	0.04
R5961:Exph5	UTSW	9	53377255	missense	probably damaging	1.00
R6093:Exph5	UTSW	9	53372617	missense	possibly damaging	0.94
R6144:Exph5	UTSW	9	53373028	missense	probably benign	0.21
R6254:Exph5	UTSW	9	53372710	missense	possibly damaging	0.81
R6279:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6300:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6485:Exph5	UTSW	9	53376691	missense	possibly damaging	0.89
R6553:Exph5	UTSW	9	53301712	start gained	probably benign
R6792:Exph5	UTSW	9	53375317	missense	possibly damaging	0.52
R7026:Exph5	UTSW	9	53340428	missense	probably benign	0.27
R7340:Exph5	UTSW	9	53377009	missense	probably damaging	0.99
R7347:Exph5	UTSW	9	53375896	missense	possibly damaging	0.79
R7352:Exph5	UTSW	9	53375722	missense	probably benign	0.00
R7521:Exph5	UTSW	9	53374077	missense	possibly damaging	0.89
R7560:Exph5	UTSW	9	53375773	missense	probably benign	0.41
R7581:Exph5	UTSW	9	53372557	missense	possibly damaging	0.90
R7726:Exph5	UTSW	9	53373175	missense	possibly damaging	0.62
R7976:Exph5	UTSW	9	53376635	missense	possibly damaging	0.79
R8017:Exph5	UTSW	9	53373452	missense	probably benign
R8019:Exph5	UTSW	9	53373452	missense	probably benign
R8302:Exph5	UTSW	9	53376476	missense	possibly damaging	0.89
R8420:Exph5	UTSW	9	53375848	nonsense	probably null
R8551:Exph5	UTSW	9	53374051	missense	possibly damaging	0.94
X0028:Exph5	UTSW	9	53376263	missense	probably damaging	1.00
Z1177:Exph5	UTSW	9	53374213	missense	probably benign	0.44
Z1177:Exph5	UTSW	9	53377419	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCGCATACTTTAGCTAGAGAAG -3'
(R):5'- AGCCTATACGCCTGTCATTC -3'

Sequencing Primer
(F):5'- CCAGTTGCCAGTGTGTTT -3'
(R):5'- ATACGCCTGTCATTCTTTGATCTCAG -3'

Posted On

2019-10-17