Incidental Mutation 'R7520:Adck1'
ID582642
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene NameaarF domain containing kinase 1
Synonyms2610005A10Rik
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7520 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location88360554-88461724 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88459205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
Predicted Effect probably null
Transcript: ENSMUST00000101165
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166940
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222695
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,114 I886N probably benign Het
Adamts6 A G 13: 104,297,186 H41R probably benign Het
Atat1 G T 17: 35,897,814 T398K probably benign Het
Bahcc1 A G 11: 120,276,205 E1144G possibly damaging Het
Cand2 G T 6: 115,785,251 E213* probably null Het
Cep350 A G 1: 155,915,629 S1250P probably benign Het
Cln3 A G 7: 126,581,680 L63P probably damaging Het
Col4a4 A T 1: 82,507,087 C486* probably null Het
Ctnnal1 A T 4: 56,837,838 M264K probably damaging Het
Ddr2 T A 1: 169,984,439 D738V probably damaging Het
Dnah6 T C 6: 73,127,904 M1901V probably benign Het
Dnhd1 A G 7: 105,696,048 T2200A probably benign Het
Dolk A G 2: 30,284,543 Y497H probably benign Het
Drd5 T C 5: 38,320,852 V396A probably benign Het
Erich3 A G 3: 154,763,126 T1072A unknown Het
Ero1l A T 14: 45,306,575 N57K probably damaging Het
Exph5 T C 9: 53,367,214 probably null Het
Frmd5 C T 2: 121,554,264 probably null Het
Gm13124 T C 4: 144,555,289 Y311C probably damaging Het
H2-Q7 A G 17: 35,442,710 T310A probably benign Het
Hecw2 G T 1: 53,926,056 A537E probably benign Het
Itga4 A T 2: 79,300,989 D567V probably damaging Het
Kcnu1 A T 8: 25,885,340 N361Y probably damaging Het
Keap1 A G 9: 21,233,491 S408P probably benign Het
Mamdc4 T A 2: 25,565,348 I928F possibly damaging Het
Mboat4 T C 8: 34,123,874 F155S probably benign Het
Mtbp A G 15: 55,577,346 probably benign Het
Nmi T G 2: 51,952,480 K200T probably benign Het
Olfr138 G A 17: 38,275,440 C223Y probably benign Het
Olfr27 G T 9: 39,144,118 R6L probably benign Het
Pcdha7 G A 18: 36,975,313 V464M probably damaging Het
Peg10 T A 6: 4,756,796 N457K unknown Het
Plekha7 A T 7: 116,137,284 I944N possibly damaging Het
Plpp1 T A 13: 112,801,247 D13E possibly damaging Het
Pnpla6 G T 8: 3,537,508 V1070F probably damaging Het
Riox1 T A 12: 83,951,771 Y360* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sdhb A G 4: 140,966,571 D50G possibly damaging Het
Slc35f2 T A 9: 53,801,101 V126D possibly damaging Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Snap91 T A 9: 86,839,649 I46F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Taar7b T C 10: 24,000,483 L182P probably damaging Het
Tmc1 T A 19: 20,799,178 M606L probably damaging Het
Trpm8 T A 1: 88,343,321 D444E probably benign Het
Tsen54 A G 11: 115,820,971 T405A probably damaging Het
Ttll5 T C 12: 85,899,471 W492R probably damaging Het
Ttn T A 2: 76,897,779 T5566S unknown Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
Zfand1 A G 3: 10,345,949 V115A probably damaging Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCCCTTGCTGCTATTAGGAC -3'
(R):5'- AGCATTTTAGGCCACCCAAAG -3'

Sequencing Primer
(F):5'- CTGCTATTAGGACTCAGAGATTCGC -3'
(R):5'- GACACTGTCTCAAGGCATCTG -3'
Posted On2019-10-17