Incidental Mutation 'R7520:Mtbp'
ID582647
Institutional Source Beutler Lab
Gene Symbol Mtbp
Ensembl Gene ENSMUSG00000022369
Gene NameMdm2, transformed 3T3 cell double minute p53 binding protein
SynonymsMDM2BP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7520 (G1)
Quality Score212.009
Status Validated
Chromosome15
Chromosomal Location55557408-55626423 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 55577346 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022998] [ENSMUST00000169667] [ENSMUST00000170046]
Predicted Effect probably benign
Transcript: ENSMUST00000022998
SMART Domains Protein: ENSMUSP00000022998
Gene: ENSMUSG00000022369

DomainStartEndE-ValueType
Pfam:MTBP_N 1 270 1.2e-116 PFAM
Pfam:MTBP_mid 287 626 1.4e-161 PFAM
Pfam:MTBP_C 630 884 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169667
SMART Domains Protein: ENSMUSP00000128615
Gene: ENSMUSG00000022369

DomainStartEndE-ValueType
Pfam:MTBP_mid 1 253 2.3e-119 PFAM
Pfam:MTBP_C 257 511 2.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170046
SMART Domains Protein: ENSMUSP00000129396
Gene: ENSMUSG00000022369

DomainStartEndE-ValueType
Pfam:MTBP_N 1 276 3.4e-145 PFAM
Pfam:MTBP_mid 286 626 3.1e-171 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality; interestingly, heterozygous mice are not tumor prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,114 I886N probably benign Het
Adamts6 A G 13: 104,297,186 H41R probably benign Het
Adck1 T C 12: 88,459,205 probably null Het
Atat1 G T 17: 35,897,814 T398K probably benign Het
Bahcc1 A G 11: 120,276,205 E1144G possibly damaging Het
Cand2 G T 6: 115,785,251 E213* probably null Het
Cep350 A G 1: 155,915,629 S1250P probably benign Het
Cln3 A G 7: 126,581,680 L63P probably damaging Het
Col4a4 A T 1: 82,507,087 C486* probably null Het
Ctnnal1 A T 4: 56,837,838 M264K probably damaging Het
Ddr2 T A 1: 169,984,439 D738V probably damaging Het
Dnah6 T C 6: 73,127,904 M1901V probably benign Het
Dnhd1 A G 7: 105,696,048 T2200A probably benign Het
Dolk A G 2: 30,284,543 Y497H probably benign Het
Drd5 T C 5: 38,320,852 V396A probably benign Het
Epsti1 A T 14: 77,963,443 probably null Het
Erich3 A G 3: 154,763,126 T1072A unknown Het
Ero1l A T 14: 45,306,575 N57K probably damaging Het
Exph5 T C 9: 53,367,214 probably null Het
Frmd5 C T 2: 121,554,264 probably null Het
Gm13124 T C 4: 144,555,289 Y311C probably damaging Het
H2-Q7 A G 17: 35,442,710 T310A probably benign Het
Hecw2 G T 1: 53,926,056 A537E probably benign Het
Itga4 A T 2: 79,300,989 D567V probably damaging Het
Kcnu1 A T 8: 25,885,340 N361Y probably damaging Het
Keap1 A G 9: 21,233,491 S408P probably benign Het
Mamdc4 T A 2: 25,565,348 I928F possibly damaging Het
Mboat4 T C 8: 34,123,874 F155S probably benign Het
Nmi T G 2: 51,952,480 K200T probably benign Het
Olfr138 G A 17: 38,275,440 C223Y probably benign Het
Olfr27 G T 9: 39,144,118 R6L probably benign Het
Pcdha7 G A 18: 36,975,313 V464M probably damaging Het
Peg10 T A 6: 4,756,796 N457K unknown Het
Plekha7 A T 7: 116,137,284 I944N possibly damaging Het
Plpp1 T A 13: 112,801,247 D13E possibly damaging Het
Pnpla6 G T 8: 3,537,508 V1070F probably damaging Het
Riox1 T A 12: 83,951,771 Y360* probably null Het
Sdhb A G 4: 140,966,571 D50G possibly damaging Het
Slc35f2 T A 9: 53,801,101 V126D possibly damaging Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Snap91 T A 9: 86,839,649 I46F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Taar7b T C 10: 24,000,483 L182P probably damaging Het
Tmc1 T A 19: 20,799,178 M606L probably damaging Het
Trpm8 T A 1: 88,343,321 D444E probably benign Het
Tsen54 A G 11: 115,820,971 T405A probably damaging Het
Ttll5 T C 12: 85,899,471 W492R probably damaging Het
Ttn T A 2: 76,897,779 T5566S unknown Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
Zfand1 A G 3: 10,345,949 V115A probably damaging Het
Other mutations in Mtbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Mtbp APN 15 55617508 nonsense probably null
IGL00988:Mtbp APN 15 55558498 unclassified probably benign
IGL01608:Mtbp APN 15 55557689 nonsense probably null
IGL02422:Mtbp APN 15 55563043 missense possibly damaging 0.59
IGL02664:Mtbp APN 15 55619643 missense probably benign 0.01
IGL03160:Mtbp APN 15 55620617 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0280:Mtbp UTSW 15 55586461 missense probably benign 0.04
R0302:Mtbp UTSW 15 55625424 missense probably damaging 0.99
R0387:Mtbp UTSW 15 55611029 missense possibly damaging 0.82
R0402:Mtbp UTSW 15 55569070 nonsense probably null
R0648:Mtbp UTSW 15 55603201 missense probably benign
R0735:Mtbp UTSW 15 55562942 nonsense probably null
R0845:Mtbp UTSW 15 55563090 critical splice donor site probably null
R1186:Mtbp UTSW 15 55564671 missense probably null 1.00
R1398:Mtbp UTSW 15 55577537 nonsense probably null
R1500:Mtbp UTSW 15 55617555 missense probably damaging 0.99
R1712:Mtbp UTSW 15 55571294 critical splice acceptor site probably null
R1893:Mtbp UTSW 15 55557668 missense probably benign 0.37
R1902:Mtbp UTSW 15 55606715 missense probably damaging 0.99
R1917:Mtbp UTSW 15 55564677 splice site probably benign
R2267:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2268:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2269:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2383:Mtbp UTSW 15 55566194 missense probably damaging 1.00
R2512:Mtbp UTSW 15 55577536 missense probably damaging 0.98
R2924:Mtbp UTSW 15 55619814 missense probably benign 0.21
R2925:Mtbp UTSW 15 55619814 missense probably benign 0.21
R4164:Mtbp UTSW 15 55609521 missense probably benign
R4232:Mtbp UTSW 15 55620677 nonsense probably null
R4255:Mtbp UTSW 15 55620685 missense possibly damaging 0.66
R4438:Mtbp UTSW 15 55603215 missense probably benign 0.41
R5009:Mtbp UTSW 15 55603187 missense probably benign
R5132:Mtbp UTSW 15 55558569 missense possibly damaging 0.92
R5685:Mtbp UTSW 15 55562772 missense probably damaging 1.00
R5933:Mtbp UTSW 15 55571327 missense possibly damaging 0.92
R6377:Mtbp UTSW 15 55557620 start codon destroyed probably null 0.32
R6554:Mtbp UTSW 15 55567249 missense probably damaging 0.99
R6811:Mtbp UTSW 15 55606546 splice site probably null
R6942:Mtbp UTSW 15 55567200 missense probably damaging 0.99
R7134:Mtbp UTSW 15 55558565 missense probably benign 0.00
R7374:Mtbp UTSW 15 55562959 missense possibly damaging 0.95
R7397:Mtbp UTSW 15 55569151 missense probably benign 0.06
R7655:Mtbp UTSW 15 55609526 missense unknown
R7656:Mtbp UTSW 15 55609526 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCCATAACACACAAGTACAG -3'
(R):5'- TCCACTTTCTTGAGGCCAGTT -3'

Sequencing Primer
(F):5'- GAAAATACCGTTTGCGCCTG -3'
(R):5'- CAGTTGGCTGGGAGGTG -3'
Posted On2019-10-17