Incidental Mutation 'R7521:Clca3a2'
ID582659
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Namechloride channel accessory 3A2
SynonymsClca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7521 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144796559-144819494 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 144801913 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 190 (*190R)
Ref Sequence ENSEMBL: ENSMUSP00000143543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
Predicted Effect probably benign
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect probably null
Transcript: ENSMUST00000199029
AA Change: *190R
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262
AA Change: *190R

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,064,569 N76S probably benign Het
Ahnak T C 19: 9,002,351 V333A possibly damaging Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b GGCGGC GGCGGCAGCGGC 17: 4,995,860 probably benign Het
Arid1b A G 17: 5,342,590 T2079A probably benign Het
Cntnap3 G T 13: 64,772,001 Q681K probably benign Het
Coro7 T C 16: 4,631,482 D689G probably benign Het
Dnah9 A T 11: 65,989,837 S2645T probably damaging Het
Dnm3 A T 1: 162,134,544 L32H probably damaging Het
Dtx4 T C 19: 12,492,497 K89E probably benign Het
Exph5 T A 9: 53,374,077 N819K possibly damaging Het
Fpgt A G 3: 155,087,128 S421P possibly damaging Het
Gbp5 T C 3: 142,500,621 V22A probably benign Het
Gpatch1 C T 7: 35,293,788 R544Q probably damaging Het
Grm5 T A 7: 88,074,272 L590Q possibly damaging Het
Hc T C 2: 35,045,332 D172G possibly damaging Het
Ifi209 A T 1: 173,642,695 N283I probably damaging Het
Igsf11 C T 16: 39,008,912 T115M probably damaging Het
Il17rd T A 14: 27,094,866 M320K probably benign Het
Kdm5a T A 6: 120,432,187 C1610* probably null Het
Mast3 T A 8: 70,788,768 I175L probably benign Het
Mif A T 10: 75,860,108 S21T possibly damaging Het
Mindy2 T C 9: 70,607,510 Q542R probably benign Het
Nalcn T A 14: 123,293,458 E1389D probably damaging Het
Olfr1101 T A 2: 86,988,610 T189S probably damaging Het
Olfr175-ps1 T C 16: 58,823,894 I272V probably benign Het
Olfr543 C T 7: 102,477,195 R225H possibly damaging Het
Olfr873 T C 9: 20,300,740 I181T probably benign Het
Pcsk5 T A 19: 17,454,832 D1473V probably benign Het
Phax C T 18: 56,575,918 Q185* probably null Het
Ppp2r2b T A 18: 43,059,177 S22C probably benign Het
Prss40 A G 1: 34,558,009 F153L probably benign Het
Slc22a2 T C 17: 12,586,823 S154P probably benign Het
Speer4a G A 5: 26,036,765 T121I probably damaging Het
Tacc1 A G 8: 25,175,252 V488A possibly damaging Het
Tdrp G A 8: 13,953,831 Q169* probably null Het
Tmem30b C T 12: 73,545,318 R341H probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 unclassified probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7972:Clca3a2 UTSW 3 144810813 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAATTTCAAGGTCGCACGGAC -3'
(R):5'- ATTTACTGTGTCTGGAGCGCC -3'

Sequencing Primer
(F):5'- AGTCAGGGACAGGACATTATTATTAG -3'
(R):5'- CCCCTGATGGCGACCATG -3'
Posted On2019-10-17