Incidental Mutation 'R7521:Exph5'
ID 582670
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 045593-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7521 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53285377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 819 (N819K)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect possibly damaging
Transcript: ENSMUST00000051014
AA Change: N819K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: N819K

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,283,543 (GRCm39) N76S probably benign Het
Ahnak T C 19: 8,979,715 (GRCm39) V333A possibly damaging Het
Arid1b GGCGGC GGCGGCAGCGGC 17: 5,046,135 (GRCm39) probably benign Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 5,046,119 (GRCm39) probably benign Het
Arid1b A G 17: 5,392,865 (GRCm39) T2079A probably benign Het
Clca3a2 A G 3: 144,507,674 (GRCm39) *190R probably null Het
Cntnap3 G T 13: 64,919,815 (GRCm39) Q681K probably benign Het
Coro7 T C 16: 4,449,346 (GRCm39) D689G probably benign Het
Dnah9 A T 11: 65,880,663 (GRCm39) S2645T probably damaging Het
Dnm3 A T 1: 161,962,113 (GRCm39) L32H probably damaging Het
Dtx4 T C 19: 12,469,861 (GRCm39) K89E probably benign Het
Fpgt A G 3: 154,792,765 (GRCm39) S421P possibly damaging Het
Gbp5 T C 3: 142,206,382 (GRCm39) V22A probably benign Het
Gpatch1 C T 7: 34,993,213 (GRCm39) R544Q probably damaging Het
Grm5 T A 7: 87,723,480 (GRCm39) L590Q possibly damaging Het
Hc T C 2: 34,935,344 (GRCm39) D172G possibly damaging Het
Ifi209 A T 1: 173,470,261 (GRCm39) N283I probably damaging Het
Igsf11 C T 16: 38,829,274 (GRCm39) T115M probably damaging Het
Il17rd T A 14: 26,816,823 (GRCm39) M320K probably benign Het
Kdm5a T A 6: 120,409,148 (GRCm39) C1610* probably null Het
Mast3 T A 8: 71,241,412 (GRCm39) I175L probably benign Het
Mif A T 10: 75,695,942 (GRCm39) S21T possibly damaging Het
Mindy2 T C 9: 70,514,792 (GRCm39) Q542R probably benign Het
Nalcn T A 14: 123,530,870 (GRCm39) E1389D probably damaging Het
Or55b3 C T 7: 102,126,402 (GRCm39) R225H possibly damaging Het
Or5k8 T C 16: 58,644,257 (GRCm39) I272V probably benign Het
Or5t16 T A 2: 86,818,954 (GRCm39) T189S probably damaging Het
Or7e177 T C 9: 20,212,036 (GRCm39) I181T probably benign Het
Pcsk5 T A 19: 17,432,196 (GRCm39) D1473V probably benign Het
Phax C T 18: 56,708,990 (GRCm39) Q185* probably null Het
Ppp2r2b T A 18: 43,192,242 (GRCm39) S22C probably benign Het
Prss40 A G 1: 34,597,090 (GRCm39) F153L probably benign Het
Slc22a2 T C 17: 12,805,710 (GRCm39) S154P probably benign Het
Speer4a1 G A 5: 26,241,763 (GRCm39) T121I probably damaging Het
Tacc1 A G 8: 25,665,268 (GRCm39) V488A possibly damaging Het
Tdrp G A 8: 14,003,831 (GRCm39) Q169* probably null Het
Tmem30b C T 12: 73,592,092 (GRCm39) R341H probably benign Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCCACAGAACGTTCCAGAAG -3'
(R):5'- TGTAAAGGAGCTCGTGAGATGC -3'

Sequencing Primer
(F):5'- GAAGATCACCCAGGGTCTTCTC -3'
(R):5'- AGCTCGTGAGATGCTGTGCC -3'
Posted On 2019-10-17