Incidental Mutation 'R7521:Tmem30b'
ID 582674
Institutional Source Beutler Lab
Gene Symbol Tmem30b
Ensembl Gene ENSMUSG00000034435
Gene Name transmembrane protein 30B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7521 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73543402-73546392 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73545318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 341 (R341H)
Ref Sequence ENSEMBL: ENSMUSP00000037476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042975]
AlphaFold Q8BHG3
Predicted Effect probably benign
Transcript: ENSMUST00000042975
AA Change: R341H

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037476
Gene: ENSMUSG00000034435
AA Change: R341H

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Pfam:CDC50 54 347 3.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,064,569 N76S probably benign Het
Ahnak T C 19: 9,002,351 V333A possibly damaging Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b GGCGGC GGCGGCAGCGGC 17: 4,995,860 probably benign Het
Arid1b A G 17: 5,342,590 T2079A probably benign Het
Clca3a2 A G 3: 144,801,913 *190R probably null Het
Cntnap3 G T 13: 64,772,001 Q681K probably benign Het
Coro7 T C 16: 4,631,482 D689G probably benign Het
Dnah9 A T 11: 65,989,837 S2645T probably damaging Het
Dnm3 A T 1: 162,134,544 L32H probably damaging Het
Dtx4 T C 19: 12,492,497 K89E probably benign Het
Exph5 T A 9: 53,374,077 N819K possibly damaging Het
Fpgt A G 3: 155,087,128 S421P possibly damaging Het
Gbp5 T C 3: 142,500,621 V22A probably benign Het
Gpatch1 C T 7: 35,293,788 R544Q probably damaging Het
Grm5 T A 7: 88,074,272 L590Q possibly damaging Het
Hc T C 2: 35,045,332 D172G possibly damaging Het
Ifi209 A T 1: 173,642,695 N283I probably damaging Het
Igsf11 C T 16: 39,008,912 T115M probably damaging Het
Il17rd T A 14: 27,094,866 M320K probably benign Het
Kdm5a T A 6: 120,432,187 C1610* probably null Het
Mast3 T A 8: 70,788,768 I175L probably benign Het
Mif A T 10: 75,860,108 S21T possibly damaging Het
Mindy2 T C 9: 70,607,510 Q542R probably benign Het
Nalcn T A 14: 123,293,458 E1389D probably damaging Het
Olfr1101 T A 2: 86,988,610 T189S probably damaging Het
Olfr175-ps1 T C 16: 58,823,894 I272V probably benign Het
Olfr543 C T 7: 102,477,195 R225H possibly damaging Het
Olfr873 T C 9: 20,300,740 I181T probably benign Het
Pcsk5 T A 19: 17,454,832 D1473V probably benign Het
Phax C T 18: 56,575,918 Q185* probably null Het
Ppp2r2b T A 18: 43,059,177 S22C probably benign Het
Prss40 A G 1: 34,558,009 F153L probably benign Het
Slc22a2 T C 17: 12,586,823 S154P probably benign Het
Speer4a G A 5: 26,036,765 T121I probably damaging Het
Tacc1 A G 8: 25,175,252 V488A possibly damaging Het
Tdrp G A 8: 13,953,831 Q169* probably null Het
Other mutations in Tmem30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tmem30b UTSW 12 73546005 missense probably damaging 1.00
R0492:Tmem30b UTSW 12 73546168 missense probably benign 0.24
R0707:Tmem30b UTSW 12 73546168 missense probably benign 0.24
R2135:Tmem30b UTSW 12 73545333 missense probably damaging 1.00
R3615:Tmem30b UTSW 12 73545579 missense probably damaging 1.00
R3616:Tmem30b UTSW 12 73545579 missense probably damaging 1.00
R4858:Tmem30b UTSW 12 73545912 missense probably damaging 1.00
R4922:Tmem30b UTSW 12 73545714 missense probably damaging 1.00
R5649:Tmem30b UTSW 12 73546166 missense probably benign 0.10
R7391:Tmem30b UTSW 12 73545928 missense probably benign 0.00
R9054:Tmem30b UTSW 12 73546149 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAAATGGCAAGATGTGTCACTCTG -3'
(R):5'- GCACCTACCGTGTCAACATC -3'

Sequencing Primer
(F):5'- AAGATGTGTCACTCTGCAGTCCAG -3'
(R):5'- TCACCTACAACTACCCGGTG -3'
Posted On 2019-10-17