Incidental Mutation 'R7521:Coro7'
ID582678
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7521 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4631482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 689 (D689G)
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
AA Change: D689G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: D689G

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,064,569 N76S probably benign Het
Ahnak T C 19: 9,002,351 V333A possibly damaging Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b GGCGGC GGCGGCAGCGGC 17: 4,995,860 probably benign Het
Arid1b A G 17: 5,342,590 T2079A probably benign Het
Clca3a2 A G 3: 144,801,913 *190R probably null Het
Cntnap3 G T 13: 64,772,001 Q681K probably benign Het
Dnah9 A T 11: 65,989,837 S2645T probably damaging Het
Dnm3 A T 1: 162,134,544 L32H probably damaging Het
Dtx4 T C 19: 12,492,497 K89E probably benign Het
Exph5 T A 9: 53,374,077 N819K possibly damaging Het
Fpgt A G 3: 155,087,128 S421P possibly damaging Het
Gbp5 T C 3: 142,500,621 V22A probably benign Het
Gpatch1 C T 7: 35,293,788 R544Q probably damaging Het
Grm5 T A 7: 88,074,272 L590Q possibly damaging Het
Hc T C 2: 35,045,332 D172G possibly damaging Het
Ifi209 A T 1: 173,642,695 N283I probably damaging Het
Igsf11 C T 16: 39,008,912 T115M probably damaging Het
Il17rd T A 14: 27,094,866 M320K probably benign Het
Kdm5a T A 6: 120,432,187 C1610* probably null Het
Mast3 T A 8: 70,788,768 I175L probably benign Het
Mif A T 10: 75,860,108 S21T possibly damaging Het
Mindy2 T C 9: 70,607,510 Q542R probably benign Het
Nalcn T A 14: 123,293,458 E1389D probably damaging Het
Olfr1101 T A 2: 86,988,610 T189S probably damaging Het
Olfr175-ps1 T C 16: 58,823,894 I272V probably benign Het
Olfr543 C T 7: 102,477,195 R225H possibly damaging Het
Olfr873 T C 9: 20,300,740 I181T probably benign Het
Pcsk5 T A 19: 17,454,832 D1473V probably benign Het
Phax C T 18: 56,575,918 Q185* probably null Het
Ppp2r2b T A 18: 43,059,177 S22C probably benign Het
Prss40 A G 1: 34,558,009 F153L probably benign Het
Slc22a2 T C 17: 12,586,823 S154P probably benign Het
Speer4a G A 5: 26,036,765 T121I probably damaging Het
Tacc1 A G 8: 25,175,252 V488A possibly damaging Het
Tdrp G A 8: 13,953,831 Q169* probably null Het
Tmem30b C T 12: 73,545,318 R341H probably benign Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R7929:Coro7 UTSW 16 4670536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCGATAATCCACTGATCCATTG -3'
(R):5'- AGGGTCTATGAATGAGCCTTGG -3'

Sequencing Primer
(F):5'- AGACAGGGTCTCTCTACTATGTAGTC -3'
(R):5'- CACCTTTGGGCTAAAGGT -3'
Posted On2019-10-17