Incidental Mutation 'R7521:Arid1b'
ID582681
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R7521 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GGGCGGCGGCGGCGGCGGCGGCGG to GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG at 4995844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably benign
Transcript: ENSMUST00000092723
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115799
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232180
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,064,569 N76S probably benign Het
Ahnak T C 19: 9,002,351 V333A possibly damaging Het
Clca3a2 A G 3: 144,801,913 *190R probably null Het
Cntnap3 G T 13: 64,772,001 Q681K probably benign Het
Coro7 T C 16: 4,631,482 D689G probably benign Het
Dnah9 A T 11: 65,989,837 S2645T probably damaging Het
Dnm3 A T 1: 162,134,544 L32H probably damaging Het
Dtx4 T C 19: 12,492,497 K89E probably benign Het
Exph5 T A 9: 53,374,077 N819K possibly damaging Het
Fpgt A G 3: 155,087,128 S421P possibly damaging Het
Gbp5 T C 3: 142,500,621 V22A probably benign Het
Gpatch1 C T 7: 35,293,788 R544Q probably damaging Het
Grm5 T A 7: 88,074,272 L590Q possibly damaging Het
Hc T C 2: 35,045,332 D172G possibly damaging Het
Ifi209 A T 1: 173,642,695 N283I probably damaging Het
Igsf11 C T 16: 39,008,912 T115M probably damaging Het
Il17rd T A 14: 27,094,866 M320K probably benign Het
Kdm5a T A 6: 120,432,187 C1610* probably null Het
Mast3 T A 8: 70,788,768 I175L probably benign Het
Mif A T 10: 75,860,108 S21T possibly damaging Het
Mindy2 T C 9: 70,607,510 Q542R probably benign Het
Nalcn T A 14: 123,293,458 E1389D probably damaging Het
Olfr1101 T A 2: 86,988,610 T189S probably damaging Het
Olfr175-ps1 T C 16: 58,823,894 I272V probably benign Het
Olfr543 C T 7: 102,477,195 R225H possibly damaging Het
Olfr873 T C 9: 20,300,740 I181T probably benign Het
Pcsk5 T A 19: 17,454,832 D1473V probably benign Het
Phax C T 18: 56,575,918 Q185* probably null Het
Ppp2r2b T A 18: 43,059,177 S22C probably benign Het
Prss40 A G 1: 34,558,009 F153L probably benign Het
Slc22a2 T C 17: 12,586,823 S154P probably benign Het
Speer4a G A 5: 26,036,765 T121I probably damaging Het
Tacc1 A G 8: 25,175,252 V488A possibly damaging Het
Tdrp G A 8: 13,953,831 Q169* probably null Het
Tmem30b C T 12: 73,545,318 R341H probably benign Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5290979 missense probably damaging 1.00
R7270:Arid1b UTSW 17 4996043 missense unknown
R7514:Arid1b UTSW 17 5341714 missense probably benign 0.28
R7519:Arid1b UTSW 17 4995844 small insertion probably benign
R7519:Arid1b UTSW 17 4995853 small insertion probably benign
R7521:Arid1b UTSW 17 4995860 small insertion probably benign
R7521:Arid1b UTSW 17 5342590 missense probably benign 0.06
R7616:Arid1b UTSW 17 4995386 missense unknown
R7654:Arid1b UTSW 17 5291085 missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5336820 missense probably benign 0.28
R7828:Arid1b UTSW 17 5097668 missense probably damaging 1.00
R7864:Arid1b UTSW 17 5342255 missense probably damaging 1.00
R7998:Arid1b UTSW 17 5327684 missense probably damaging 1.00
R8105:Arid1b UTSW 17 5291243 missense possibly damaging 0.81
R8260:Arid1b UTSW 17 5332513 missense probably benign 0.03
R8374:Arid1b UTSW 17 5342644 missense possibly damaging 0.95
RF007:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995595 small insertion probably benign
RF025:Arid1b UTSW 17 4995588 small insertion probably benign
RF025:Arid1b UTSW 17 4995596 small insertion probably benign
RF028:Arid1b UTSW 17 4995598 small insertion probably benign
RF032:Arid1b UTSW 17 4995588 small insertion probably benign
RF033:Arid1b UTSW 17 4995585 small insertion probably benign
RF041:Arid1b UTSW 17 4995595 small insertion probably benign
RF045:Arid1b UTSW 17 4995583 small insertion probably benign
RF046:Arid1b UTSW 17 4995590 small insertion probably benign
RF058:Arid1b UTSW 17 4995583 small insertion probably benign
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Z1177:Arid1b UTSW 17 4996328 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCTTGCTTTGATCAACATGGC -3'
(R):5'- CGTAGCTCCTCATCATGGG -3'

Sequencing Primer
(F):5'- TTTGATCAACATGGCGGACAAC -3'
(R):5'- TCCTCATCATGGGGCTGG -3'
Posted On2019-10-17