Mutagenetix > Incidental Mutations

Incidental Mutation 'R7521:Arid1b'

582681

Institutional Source

Beutler Lab

Gene Symbol

Arid1b

Ensembl Gene

ENSMUSG00000069729

Gene Name

AT rich interactive domain 1B (SWI-like)

Synonyms

B230217J03Rik, 9330189K18Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene?

Probably essential (E-score: 0.803) question?

Stock #

R7521 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

4994332-5347656 bp(+) (GRCm38)

Type of Mutation

small insertion (2 aa in frame mutation)

DNA Base Change (assembly)

GGGCGGCGGCGGCGGCGGCGGCGG to GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG at 4995844 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]

Predicted Effect

probably benign
Transcript: ENSMUST00000092723

SMART Domains

Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

Domain	Start	End	E-Value	Type
low complexity region	2	51	N/A	INTRINSIC
low complexity region	69	132	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	201	224	N/A	INTRINSIC
low complexity region	232	247	N/A	INTRINSIC
low complexity region	257	276	N/A	INTRINSIC
low complexity region	301	371	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	438	476	N/A	INTRINSIC
low complexity region	485	499	N/A	INTRINSIC
low complexity region	538	558	N/A	INTRINSIC
low complexity region	574	591	N/A	INTRINSIC
low complexity region	596	611	N/A	INTRINSIC
low complexity region	615	640	N/A	INTRINSIC
low complexity region	691	707	N/A	INTRINSIC
low complexity region	719	740	N/A	INTRINSIC
low complexity region	743	773	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	912	930	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	974	985	N/A	INTRINSIC
low complexity region	1036	1045	N/A	INTRINSIC
ARID	1057	1147	9.9e-33	SMART
BRIGHT	1061	1152	7.62e-41	SMART
low complexity region	1166	1177	N/A	INTRINSIC
low complexity region	1257	1268	N/A	INTRINSIC
low complexity region	1336	1364	N/A	INTRINSIC
low complexity region	1426	1456	N/A	INTRINSIC
low complexity region	1473	1486	N/A	INTRINSIC
low complexity region	1579	1595	N/A	INTRINSIC
coiled coil region	1724	1745	N/A	INTRINSIC
low complexity region	1835	1843	N/A	INTRINSIC
Pfam:DUF3518	1933	2189	1.5e-152	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115797

SMART Domains

Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

Domain	Start	End	E-Value	Type
low complexity region	17	80	N/A	INTRINSIC
low complexity region	87	98	N/A	INTRINSIC
low complexity region	149	172	N/A	INTRINSIC
low complexity region	180	195	N/A	INTRINSIC
low complexity region	205	224	N/A	INTRINSIC
low complexity region	249	319	N/A	INTRINSIC
low complexity region	327	355	N/A	INTRINSIC
low complexity region	386	424	N/A	INTRINSIC
low complexity region	433	447	N/A	INTRINSIC
low complexity region	486	506	N/A	INTRINSIC
low complexity region	522	539	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
low complexity region	563	588	N/A	INTRINSIC
low complexity region	639	655	N/A	INTRINSIC
low complexity region	667	688	N/A	INTRINSIC
low complexity region	691	721	N/A	INTRINSIC
low complexity region	753	764	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	884	900	N/A	INTRINSIC
low complexity region	922	933	N/A	INTRINSIC
Blast:ARID	981	1028	1e-8	BLAST
low complexity region	1029	1054	N/A	INTRINSIC
ARID	1058	1148	9.9e-33	SMART
BRIGHT	1062	1153	7.62e-41	SMART
low complexity region	1167	1178	N/A	INTRINSIC
low complexity region	1258	1269	N/A	INTRINSIC
low complexity region	1337	1365	N/A	INTRINSIC
low complexity region	1427	1457	N/A	INTRINSIC
low complexity region	1474	1487	N/A	INTRINSIC
low complexity region	1580	1596	N/A	INTRINSIC
coiled coil region	1725	1746	N/A	INTRINSIC
low complexity region	1836	1844	N/A	INTRINSIC
Pfam:DUF3518	1935	2190	6.3e-121	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115799

SMART Domains

Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

Domain	Start	End	E-Value	Type
low complexity region	34	54	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	92	107	N/A	INTRINSIC
low complexity region	111	136	N/A	INTRINSIC
low complexity region	187	203	N/A	INTRINSIC
low complexity region	215	236	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	402	418	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
Blast:ARID	499	546	1e-8	BLAST
low complexity region	547	572	N/A	INTRINSIC
ARID	576	666	9.9e-33	SMART
BRIGHT	580	671	7.62e-41	SMART
low complexity region	685	696	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	855	883	N/A	INTRINSIC
low complexity region	945	975	N/A	INTRINSIC
low complexity region	992	1005	N/A	INTRINSIC
low complexity region	1098	1114	N/A	INTRINSIC
coiled coil region	1243	1264	N/A	INTRINSIC
low complexity region	1354	1362	N/A	INTRINSIC
Pfam:DUF3518	1452	1708	1.1e-152	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000232180

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	A	G	17: 31,064,569	N76S	probably benign	Het
Ahnak	T	C	19: 9,002,351	V333A	possibly damaging	Het
Clca3a2	A	G	3: 144,801,913	*190R	probably null	Het
Cntnap3	G	T	13: 64,772,001	Q681K	probably benign	Het
Coro7	T	C	16: 4,631,482	D689G	probably benign	Het
Dnah9	A	T	11: 65,989,837	S2645T	probably damaging	Het
Dnm3	A	T	1: 162,134,544	L32H	probably damaging	Het
Dtx4	T	C	19: 12,492,497	K89E	probably benign	Het
Exph5	T	A	9: 53,374,077	N819K	possibly damaging	Het
Fpgt	A	G	3: 155,087,128	S421P	possibly damaging	Het
Gbp5	T	C	3: 142,500,621	V22A	probably benign	Het
Gpatch1	C	T	7: 35,293,788	R544Q	probably damaging	Het
Grm5	T	A	7: 88,074,272	L590Q	possibly damaging	Het
Hc	T	C	2: 35,045,332	D172G	possibly damaging	Het
Ifi209	A	T	1: 173,642,695	N283I	probably damaging	Het
Igsf11	C	T	16: 39,008,912	T115M	probably damaging	Het
Il17rd	T	A	14: 27,094,866	M320K	probably benign	Het
Kdm5a	T	A	6: 120,432,187	C1610*	probably null	Het
Mast3	T	A	8: 70,788,768	I175L	probably benign	Het
Mif	A	T	10: 75,860,108	S21T	possibly damaging	Het
Mindy2	T	C	9: 70,607,510	Q542R	probably benign	Het
Nalcn	T	A	14: 123,293,458	E1389D	probably damaging	Het
Olfr1101	T	A	2: 86,988,610	T189S	probably damaging	Het
Olfr175-ps1	T	C	16: 58,823,894	I272V	probably benign	Het
Olfr543	C	T	7: 102,477,195	R225H	possibly damaging	Het
Olfr873	T	C	9: 20,300,740	I181T	probably benign	Het
Pcsk5	T	A	19: 17,454,832	D1473V	probably benign	Het
Phax	C	T	18: 56,575,918	Q185*	probably null	Het
Ppp2r2b	T	A	18: 43,059,177	S22C	probably benign	Het
Prss40	A	G	1: 34,558,009	F153L	probably benign	Het
Slc22a2	T	C	17: 12,586,823	S154P	probably benign	Het
Speer4a	G	A	5: 26,036,765	T121I	probably damaging	Het
Tacc1	A	G	8: 25,175,252	V488A	possibly damaging	Het
Tdrp	G	A	8: 13,953,831	Q169*	probably null	Het
Tmem30b	C	T	12: 73,545,318	R341H	probably benign	Het

Other mutations in Arid1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Arid1b	APN	17	5337110	missense	possibly damaging	0.77
IGL00340:Arid1b	APN	17	5321284	missense	probably damaging	1.00
IGL00886:Arid1b	APN	17	5126979	missense	probably damaging	0.99
IGL01161:Arid1b	APN	17	5342399	missense	probably damaging	1.00
IGL01391:Arid1b	APN	17	5318858	splice site	probably benign
IGL01456:Arid1b	APN	17	5291235	missense	probably damaging	1.00
IGL02152:Arid1b	APN	17	5313968	missense	probably damaging	1.00
IGL02288:Arid1b	APN	17	5264040	missense	possibly damaging	0.88
IGL02713:Arid1b	APN	17	5343011	missense	probably damaging	1.00
IGL02858:Arid1b	APN	17	5341891	missense	possibly damaging	0.92
IGL02885:Arid1b	APN	17	5342153	missense	probably damaging	1.00
IGL02989:Arid1b	APN	17	5335047	missense	probably damaging	1.00
FR4449:Arid1b	UTSW	17	4995589	small insertion	probably benign
PIT4142001:Arid1b	UTSW	17	5339243	missense	probably damaging	1.00
R0048:Arid1b	UTSW	17	5314034	critical splice donor site	probably null
R0124:Arid1b	UTSW	17	5339330	missense	probably damaging	1.00
R0153:Arid1b	UTSW	17	5342932	missense	probably damaging	1.00
R0465:Arid1b	UTSW	17	4996260	missense	possibly damaging	0.68
R0825:Arid1b	UTSW	17	5342178	missense	probably damaging	1.00
R1172:Arid1b	UTSW	17	5339300	missense	probably damaging	1.00
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1616:Arid1b	UTSW	17	5339294	missense	probably damaging	1.00
R1754:Arid1b	UTSW	17	5279201	critical splice acceptor site	probably null
R1760:Arid1b	UTSW	17	5341813	missense	probably damaging	0.97
R1812:Arid1b	UTSW	17	5337029	missense	probably benign	0.10
R1911:Arid1b	UTSW	17	5342966	missense	probably damaging	1.00
R3874:Arid1b	UTSW	17	5336515	splice site	probably null
R3913:Arid1b	UTSW	17	5342257	missense	possibly damaging	0.94
R3916:Arid1b	UTSW	17	5342653	missense	probably benign	0.25
R3922:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R4119:Arid1b	UTSW	17	4995794	unclassified	probably benign
R4290:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4291:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4352:Arid1b	UTSW	17	5097584	missense	possibly damaging	0.93
R4386:Arid1b	UTSW	17	4994972	unclassified	probably benign
R4458:Arid1b	UTSW	17	5242916	missense	probably damaging	0.99
R4524:Arid1b	UTSW	17	5097620	missense	possibly damaging	0.93
R4622:Arid1b	UTSW	17	4995050	unclassified	probably benign
R4723:Arid1b	UTSW	17	5337290	missense	probably benign	0.01
R4782:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4799:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4910:Arid1b	UTSW	17	5342203	missense	probably damaging	1.00
R4946:Arid1b	UTSW	17	5342843	missense	probably damaging	0.99
R5083:Arid1b	UTSW	17	5314018	missense	possibly damaging	0.54
R5204:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R5347:Arid1b	UTSW	17	5291057	nonsense	probably null
R5553:Arid1b	UTSW	17	5313877	missense	probably damaging	1.00
R5713:Arid1b	UTSW	17	5336816	missense	probably damaging	1.00
R5820:Arid1b	UTSW	17	4996254	missense	possibly damaging	0.96
R5992:Arid1b	UTSW	17	4994956	unclassified	probably benign
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6153:Arid1b	UTSW	17	5242832	missense	probably damaging	1.00
R6222:Arid1b	UTSW	17	5327647	critical splice acceptor site	probably null
R6249:Arid1b	UTSW	17	5279361	missense	possibly damaging	0.61
R6279:Arid1b	UTSW	17	5341999	missense	probably damaging	1.00
R6329:Arid1b	UTSW	17	5337263	nonsense	probably null
R6368:Arid1b	UTSW	17	5332533	missense	possibly damaging	0.64
R6466:Arid1b	UTSW	17	5327678	missense	probably damaging	1.00
R6861:Arid1b	UTSW	17	5327686	missense	possibly damaging	0.93
R7008:Arid1b	UTSW	17	5290979	missense	probably damaging	1.00
R7270:Arid1b	UTSW	17	4996043	missense	unknown
R7514:Arid1b	UTSW	17	5341714	missense	probably benign	0.28
R7519:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7519:Arid1b	UTSW	17	4995853	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995860	small insertion	probably benign
R7521:Arid1b	UTSW	17	5342590	missense	probably benign	0.06
R7616:Arid1b	UTSW	17	4995386	missense	unknown
R7654:Arid1b	UTSW	17	5291085	missense	possibly damaging	0.46
R7711:Arid1b	UTSW	17	5336820	missense	probably benign	0.28
R7828:Arid1b	UTSW	17	5097668	missense	probably damaging	1.00
R7864:Arid1b	UTSW	17	5342255	missense	probably damaging	1.00
R7998:Arid1b	UTSW	17	5327684	missense	probably damaging	1.00
R8105:Arid1b	UTSW	17	5291243	missense	possibly damaging	0.81
R8260:Arid1b	UTSW	17	5332513	missense	probably benign	0.03
R8374:Arid1b	UTSW	17	5342644	missense	possibly damaging	0.95
RF007:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995596	small insertion	probably benign
RF028:Arid1b	UTSW	17	4995598	small insertion	probably benign
RF032:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF033:Arid1b	UTSW	17	4995585	small insertion	probably benign
RF041:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF045:Arid1b	UTSW	17	4995583	small insertion	probably benign
RF046:Arid1b	UTSW	17	4995590	small insertion	probably benign
RF058:Arid1b	UTSW	17	4995583	small insertion	probably benign
X0023:Arid1b	UTSW	17	5342393	missense	probably benign	0.39
X0027:Arid1b	UTSW	17	5342372	nonsense	probably null
Z1177:Arid1b	UTSW	17	4996328	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CCTTGCTTTGATCAACATGGC -3'
(R):5'- CGTAGCTCCTCATCATGGG -3'

Sequencing Primer
(F):5'- TTTGATCAACATGGCGGACAAC -3'
(R):5'- TCCTCATCATGGGGCTGG -3'

Posted On

2019-10-17