Incidental Mutation 'R7522:Plcl1'
ID582691
Institutional Source Beutler Lab
Gene Symbol Plcl1
Ensembl Gene ENSMUSG00000038349
Gene Namephospholipase C-like 1
SynonymsPRIP-1, C230017K02Rik, PLC-L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R7522 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location55405921-55754285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55696364 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 288 (I288T)
Ref Sequence ENSEMBL: ENSMUSP00000037854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042986]
Predicted Effect probably benign
Transcript: ENSMUST00000042986
AA Change: I288T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: I288T

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
PH 115 226 6.98e-4 SMART
low complexity region 301 310 N/A INTRINSIC
Pfam:EF-hand_like 316 398 5.9e-27 PFAM
PLCXc 399 543 2.13e-82 SMART
low complexity region 550 564 N/A INTRINSIC
PLCYc 586 702 2.15e-69 SMART
C2 723 829 1.02e-21 SMART
low complexity region 1080 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030014E15Rik G T 1: 82,925,228 C82F unknown Het
Adam21 G C 12: 81,558,948 T680R possibly damaging Het
Adgrf4 A C 17: 42,669,784 Y137D probably benign Het
Ago3 T C 4: 126,363,807 K477R probably benign Het
Ahnak T A 19: 9,002,322 D323E probably benign Het
Amph A G 13: 19,086,545 D108G probably damaging Het
Ankrd10 A T 8: 11,632,910 C106S probably damaging Het
Bmp5 A T 9: 75,776,102 T4S probably benign Het
Brix1 G A 15: 10,476,590 R267C probably damaging Het
Calcrl G A 2: 84,373,364 S24L probably benign Het
Ccdc40 T G 11: 119,232,221 I213R possibly damaging Het
Cd300lg A G 11: 102,054,202 I413V probably benign Het
Cdh3 G A 8: 106,541,373 D347N probably damaging Het
Clcn3 T C 8: 60,941,412 T55A probably benign Het
Cnga4 A G 7: 105,405,988 T260A probably damaging Het
Cpne8 G T 15: 90,601,819 P147Q probably benign Het
Cpsf6 A G 10: 117,367,829 Y74H unknown Het
Cryl1 A T 14: 57,275,971 S264R probably benign Het
Cyp39a1 C T 17: 43,667,479 probably benign Het
Cyp4f39 T C 17: 32,486,972 S346P probably damaging Het
Ddhd1 G A 14: 45,657,647 A122V possibly damaging Het
Dnmt1 C A 9: 20,920,202 C662F probably damaging Het
E2f6 G A 12: 16,822,124 G190S probably benign Het
Esp34 A T 17: 38,559,541 I109F possibly damaging Het
Espl1 A T 15: 102,305,051 D604V probably damaging Het
Exo1 T C 1: 175,901,304 C645R probably benign Het
Fah A G 7: 84,597,074 V189A probably benign Het
Fam184b A C 5: 45,530,751 Y939D probably damaging Het
Fam49a A G 12: 12,358,056 T28A possibly damaging Het
Fchsd2 T A 7: 101,259,622 L410* probably null Het
Gak A T 5: 108,591,199 I665N possibly damaging Het
Galnt9 A G 5: 110,595,839 probably null Het
Gcg T C 2: 62,475,759 R165G probably benign Het
Hexdc T C 11: 121,218,097 V214A possibly damaging Het
Hoxb3 A T 11: 96,344,681 S145C probably damaging Het
Il18 A G 9: 50,575,340 Y23C probably damaging Het
Itgav A T 2: 83,802,029 I954F probably benign Het
Kcna4 A G 2: 107,296,255 R445G probably damaging Het
Kyat3 T A 3: 142,734,544 L343Q probably damaging Het
Lgals4 A T 7: 28,837,692 D139V possibly damaging Het
Lrp3 C T 7: 35,204,330 G197D probably damaging Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k4 T C 17: 12,261,332 Q661R probably benign Het
Marcks A C 10: 37,136,581 F153V unknown Het
Mocs1 T C 17: 49,435,264 probably null Het
Naa60 A G 16: 3,901,904 T232A probably benign Het
Olfr1189 A G 2: 88,592,661 T286A possibly damaging Het
Olfr453 T A 6: 42,744,634 I199N probably damaging Het
Olfr700 A G 7: 106,805,787 V225A probably damaging Het
Olfr845 T A 9: 19,338,998 C179* probably null Het
Oosp1 A T 19: 11,688,701 I75N probably benign Het
Opn3 A G 1: 175,665,623 V125A probably benign Het
Palb2 T C 7: 122,113,278 T947A probably damaging Het
Pde5a C T 3: 122,840,999 R730* probably null Het
Plxnb2 A G 15: 89,161,774 I966T probably benign Het
Prkcz T C 4: 155,271,285 E400G probably damaging Het
Prpf8 A G 11: 75,509,276 D2332G possibly damaging Het
Ptgds T G 2: 25,467,908 T154P probably benign Het
Rel T C 11: 23,770,676 probably null Het
Serpinb1c T A 13: 32,882,217 K248N probably benign Het
Shkbp1 A C 7: 27,347,158 W394G possibly damaging Het
Slc47a2 A G 11: 61,302,250 V559A probably benign Het
Sox6 A T 7: 115,801,578 F10I probably damaging Het
Stkld1 T C 2: 26,947,247 V303A probably benign Het
Styk1 T A 6: 131,312,840 probably null Het
Tet1 T C 10: 62,818,983 T1574A possibly damaging Het
Tkt A T 14: 30,568,223 I270F possibly damaging Het
Tmem5 A G 10: 122,081,439 W390R probably damaging Het
Trak1 A G 9: 121,442,711 E166G probably damaging Het
Tsc2 A T 17: 24,630,965 I58N probably damaging Het
Uhmk1 T A 1: 170,215,240 M1L probably benign Het
Usp50 T C 2: 126,783,226 Y21C probably damaging Het
Vmn1r180 C G 7: 23,953,260 P283A probably damaging Het
Vmn1r83 A G 7: 12,321,578 M184T possibly damaging Het
Vmn2r109 A G 17: 20,554,403 I230T probably benign Het
Other mutations in Plcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Plcl1 APN 1 55406536 missense probably benign
IGL00491:Plcl1 APN 1 55713498 critical splice donor site probably null
IGL00753:Plcl1 APN 1 55696738 missense probably damaging 1.00
IGL01415:Plcl1 APN 1 55696396 missense possibly damaging 0.92
IGL03024:Plcl1 APN 1 55695787 missense probably damaging 1.00
K3955:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
PIT4791001:Plcl1 UTSW 1 55701931 missense probably benign 0.03
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0083:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R0086:Plcl1 UTSW 1 55715583 missense probably damaging 1.00
R0092:Plcl1 UTSW 1 55696765 missense probably damaging 0.98
R0108:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R1716:Plcl1 UTSW 1 55695838 missense probably damaging 0.99
R2061:Plcl1 UTSW 1 55751345 missense probably benign 0.01
R2128:Plcl1 UTSW 1 55697838 missense probably damaging 1.00
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2873:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R3819:Plcl1 UTSW 1 55696599 missense probably benign
R3974:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R3975:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R4214:Plcl1 UTSW 1 55751335 nonsense probably null
R4400:Plcl1 UTSW 1 55715577 missense probably damaging 1.00
R4452:Plcl1 UTSW 1 55696886 missense probably benign 0.00
R4615:Plcl1 UTSW 1 55698134 missense probably benign 0.00
R5060:Plcl1 UTSW 1 55696512 missense possibly damaging 0.84
R5422:Plcl1 UTSW 1 55697384 missense probably benign 0.00
R5568:Plcl1 UTSW 1 55696150 missense possibly damaging 0.82
R5781:Plcl1 UTSW 1 55695989 missense possibly damaging 0.92
R5809:Plcl1 UTSW 1 55696001 missense probably damaging 1.00
R6009:Plcl1 UTSW 1 55696246 missense probably damaging 1.00
R6339:Plcl1 UTSW 1 55696315 missense probably damaging 1.00
R6431:Plcl1 UTSW 1 55697252 missense probably benign 0.03
R6534:Plcl1 UTSW 1 55696748 missense probably damaging 1.00
R6565:Plcl1 UTSW 1 55697958 nonsense probably null
R6678:Plcl1 UTSW 1 55695776 missense probably benign 0.13
R6773:Plcl1 UTSW 1 55751302 missense probably benign 0.03
R6925:Plcl1 UTSW 1 55406598 nonsense probably null
R7168:Plcl1 UTSW 1 55697463 missense probably damaging 1.00
R7256:Plcl1 UTSW 1 55698218 missense probably benign 0.45
R7527:Plcl1 UTSW 1 55697114 missense probably damaging 1.00
R7536:Plcl1 UTSW 1 55713481 nonsense probably null
R7585:Plcl1 UTSW 1 55406449 missense probably benign 0.00
R7591:Plcl1 UTSW 1 55697449 missense probably benign 0.01
R7689:Plcl1 UTSW 1 55697468 missense probably damaging 1.00
R7960:Plcl1 UTSW 1 55697284 missense possibly damaging 0.48
R8029:Plcl1 UTSW 1 55696078 missense probably benign 0.26
R8241:Plcl1 UTSW 1 55695817 missense probably benign 0.01
R8323:Plcl1 UTSW 1 55697736 missense possibly damaging 0.58
Z1176:Plcl1 UTSW 1 55696040 missense probably benign 0.20
Z1176:Plcl1 UTSW 1 55751284 nonsense probably null
Z1177:Plcl1 UTSW 1 55696884 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GGTACCTGGTCTCTCGTAGTAAG -3'
(R):5'- ATATCCTCAGTGATGTGGGTGAC -3'

Sequencing Primer
(F):5'- TGGTCTCTCGTAGTAAGCAACCG -3'
(R):5'- TGACACCTTGCTCAGCTTCTAAGAAG -3'
Posted On2019-10-17