Incidental Mutation 'R7522:Prpf8'
ID582736
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7522 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75509276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2332 (D2332G)
Ref Sequence ENSEMBL: ENSMUSP00000018449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000102510] [ENSMUST00000118243] [ENSMUST00000123819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: D2332G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: D2332G

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042808
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: D2332G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: D2332G

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030014E15Rik G T 1: 82,925,228 C82F unknown Het
Adam21 G C 12: 81,558,948 T680R possibly damaging Het
Adgrf4 A C 17: 42,669,784 Y137D probably benign Het
Ago3 T C 4: 126,363,807 K477R probably benign Het
Ahnak T A 19: 9,002,322 D323E probably benign Het
Amph A G 13: 19,086,545 D108G probably damaging Het
Ankrd10 A T 8: 11,632,910 C106S probably damaging Het
Bmp5 A T 9: 75,776,102 T4S probably benign Het
Brix1 G A 15: 10,476,590 R267C probably damaging Het
Calcrl G A 2: 84,373,364 S24L probably benign Het
Ccdc40 T G 11: 119,232,221 I213R possibly damaging Het
Cd300lg A G 11: 102,054,202 I413V probably benign Het
Cdh3 G A 8: 106,541,373 D347N probably damaging Het
Clcn3 T C 8: 60,941,412 T55A probably benign Het
Cnga4 A G 7: 105,405,988 T260A probably damaging Het
Cpne8 G T 15: 90,601,819 P147Q probably benign Het
Cpsf6 A G 10: 117,367,829 Y74H unknown Het
Cryl1 A T 14: 57,275,971 S264R probably benign Het
Cyp39a1 C T 17: 43,667,479 probably benign Het
Cyp4f39 T C 17: 32,486,972 S346P probably damaging Het
Ddhd1 G A 14: 45,657,647 A122V possibly damaging Het
Dnmt1 C A 9: 20,920,202 C662F probably damaging Het
E2f6 G A 12: 16,822,124 G190S probably benign Het
Esp34 A T 17: 38,559,541 I109F possibly damaging Het
Espl1 A T 15: 102,305,051 D604V probably damaging Het
Exo1 T C 1: 175,901,304 C645R probably benign Het
Fah A G 7: 84,597,074 V189A probably benign Het
Fam184b A C 5: 45,530,751 Y939D probably damaging Het
Fam49a A G 12: 12,358,056 T28A possibly damaging Het
Fchsd2 T A 7: 101,259,622 L410* probably null Het
Gak A T 5: 108,591,199 I665N possibly damaging Het
Galnt9 A G 5: 110,595,839 probably null Het
Gcg T C 2: 62,475,759 R165G probably benign Het
Hexdc T C 11: 121,218,097 V214A possibly damaging Het
Hoxb3 A T 11: 96,344,681 S145C probably damaging Het
Il18 A G 9: 50,575,340 Y23C probably damaging Het
Itgav A T 2: 83,802,029 I954F probably benign Het
Kcna4 A G 2: 107,296,255 R445G probably damaging Het
Kyat3 T A 3: 142,734,544 L343Q probably damaging Het
Lgals4 A T 7: 28,837,692 D139V possibly damaging Het
Lrp3 C T 7: 35,204,330 G197D probably damaging Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k4 T C 17: 12,261,332 Q661R probably benign Het
Marcks A C 10: 37,136,581 F153V unknown Het
Mocs1 T C 17: 49,435,264 probably null Het
Naa60 A G 16: 3,901,904 T232A probably benign Het
Olfr1189 A G 2: 88,592,661 T286A possibly damaging Het
Olfr453 T A 6: 42,744,634 I199N probably damaging Het
Olfr700 A G 7: 106,805,787 V225A probably damaging Het
Olfr845 T A 9: 19,338,998 C179* probably null Het
Oosp1 A T 19: 11,688,701 I75N probably benign Het
Opn3 A G 1: 175,665,623 V125A probably benign Het
Palb2 T C 7: 122,113,278 T947A probably damaging Het
Pde5a C T 3: 122,840,999 R730* probably null Het
Plcl1 T C 1: 55,696,364 I288T probably benign Het
Plxnb2 A G 15: 89,161,774 I966T probably benign Het
Prkcz T C 4: 155,271,285 E400G probably damaging Het
Ptgds T G 2: 25,467,908 T154P probably benign Het
Rel T C 11: 23,770,676 probably null Het
Serpinb1c T A 13: 32,882,217 K248N probably benign Het
Shkbp1 A C 7: 27,347,158 W394G possibly damaging Het
Slc47a2 A G 11: 61,302,250 V559A probably benign Het
Sox6 A T 7: 115,801,578 F10I probably damaging Het
Stkld1 T C 2: 26,947,247 V303A probably benign Het
Styk1 T A 6: 131,312,840 probably null Het
Tet1 T C 10: 62,818,983 T1574A possibly damaging Het
Tkt A T 14: 30,568,223 I270F possibly damaging Het
Tmem5 A G 10: 122,081,439 W390R probably damaging Het
Trak1 A G 9: 121,442,711 E166G probably damaging Het
Tsc2 A T 17: 24,630,965 I58N probably damaging Het
Uhmk1 T A 1: 170,215,240 M1L probably benign Het
Usp50 T C 2: 126,783,226 Y21C probably damaging Het
Vmn1r180 C G 7: 23,953,260 P283A probably damaging Het
Vmn1r83 A G 7: 12,321,578 M184T possibly damaging Het
Vmn2r109 A G 17: 20,554,403 I230T probably benign Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
BB009:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75496355 missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 splice site probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 splice site probably null
R5186:Prpf8 UTSW 11 75489783 missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75503643 missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75491495 missense probably benign 0.33
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75496158 missense probably benign 0.02
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
R7485:Prpf8 UTSW 11 75508912 nonsense probably null
R7546:Prpf8 UTSW 11 75508374 missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75491504 missense probably benign 0.03
R7699:Prpf8 UTSW 11 75500196 missense probably benign 0.02
R7731:Prpf8 UTSW 11 75508906 missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75494474 missense probably benign 0.01
R7932:Prpf8 UTSW 11 75492597 missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75502542 missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75500150 missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75499815 missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75491774 nonsense probably null
R8823:Prpf8 UTSW 11 75493456 missense probably benign 0.05
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75503334 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCATCTTGAGGTCTGGCTGC -3'
(R):5'- GCCTATGCCCAGAATTTGACCTC -3'

Sequencing Primer
(F):5'- TCTGGCTGCCTTGGAAAC -3'
(R):5'- TATGCCCAGAATTTGACCTCATAAC -3'
Posted On2019-10-17