Incidental Mutation 'R7522:Espl1'
ID 582753
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms SSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7522 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102296266-102324357 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102305051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 604 (D604V)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030014E15Rik G T 1: 82,925,228 C82F unknown Het
Adam21 G C 12: 81,558,948 T680R possibly damaging Het
Adgrf4 A C 17: 42,669,784 Y137D probably benign Het
Ago3 T C 4: 126,363,807 K477R probably benign Het
Ahnak T A 19: 9,002,322 D323E probably benign Het
Amph A G 13: 19,086,545 D108G probably damaging Het
Ankrd10 A T 8: 11,632,910 C106S probably damaging Het
Bmp5 A T 9: 75,776,102 T4S probably benign Het
Brix1 G A 15: 10,476,590 R267C probably damaging Het
Calcrl G A 2: 84,373,364 S24L probably benign Het
Ccdc40 T G 11: 119,232,221 I213R possibly damaging Het
Cd300lg A G 11: 102,054,202 I413V probably benign Het
Cdh3 G A 8: 106,541,373 D347N probably damaging Het
Clcn3 T C 8: 60,941,412 T55A probably benign Het
Cnga4 A G 7: 105,405,988 T260A probably damaging Het
Cpne8 G T 15: 90,601,819 P147Q probably benign Het
Cpsf6 A G 10: 117,367,829 Y74H unknown Het
Cryl1 A T 14: 57,275,971 S264R probably benign Het
Cyp39a1 C T 17: 43,667,479 probably benign Het
Cyp4f39 T C 17: 32,486,972 S346P probably damaging Het
Ddhd1 G A 14: 45,657,647 A122V possibly damaging Het
Dnmt1 C A 9: 20,920,202 C662F probably damaging Het
E2f6 G A 12: 16,822,124 G190S probably benign Het
Esp34 A T 17: 38,559,541 I109F possibly damaging Het
Exo1 T C 1: 175,901,304 C645R probably benign Het
Fah A G 7: 84,597,074 V189A probably benign Het
Fam184b A C 5: 45,530,751 Y939D probably damaging Het
Fam49a A G 12: 12,358,056 T28A possibly damaging Het
Fchsd2 T A 7: 101,259,622 L410* probably null Het
Gak A T 5: 108,591,199 I665N possibly damaging Het
Galnt9 A G 5: 110,595,839 probably null Het
Gcg T C 2: 62,475,759 R165G probably benign Het
Hexdc T C 11: 121,218,097 V214A possibly damaging Het
Hoxb3 A T 11: 96,344,681 S145C probably damaging Het
Il18 A G 9: 50,575,340 Y23C probably damaging Het
Itgav A T 2: 83,802,029 I954F probably benign Het
Kcna4 A G 2: 107,296,255 R445G probably damaging Het
Kyat3 T A 3: 142,734,544 L343Q probably damaging Het
Lgals4 A T 7: 28,837,692 D139V possibly damaging Het
Lrp3 C T 7: 35,204,330 G197D probably damaging Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k4 T C 17: 12,261,332 Q661R probably benign Het
Marcks A C 10: 37,136,581 F153V unknown Het
Mocs1 T C 17: 49,435,264 probably null Het
Naa60 A G 16: 3,901,904 T232A probably benign Het
Olfr1189 A G 2: 88,592,661 T286A possibly damaging Het
Olfr453 T A 6: 42,744,634 I199N probably damaging Het
Olfr700 A G 7: 106,805,787 V225A probably damaging Het
Olfr845 T A 9: 19,338,998 C179* probably null Het
Oosp1 A T 19: 11,688,701 I75N probably benign Het
Opn3 A G 1: 175,665,623 V125A probably benign Het
Palb2 T C 7: 122,113,278 T947A probably damaging Het
Pde5a C T 3: 122,840,999 R730* probably null Het
Plcl1 T C 1: 55,696,364 I288T probably benign Het
Plxnb2 A G 15: 89,161,774 I966T probably benign Het
Prkcz T C 4: 155,271,285 E400G probably damaging Het
Prpf8 A G 11: 75,509,276 D2332G possibly damaging Het
Ptgds T G 2: 25,467,908 T154P probably benign Het
Rel T C 11: 23,770,676 probably null Het
Serpinb1c T A 13: 32,882,217 K248N probably benign Het
Shkbp1 A C 7: 27,347,158 W394G possibly damaging Het
Slc47a2 A G 11: 61,302,250 V559A probably benign Het
Sox6 A T 7: 115,801,578 F10I probably damaging Het
Stkld1 T C 2: 26,947,247 V303A probably benign Het
Styk1 T A 6: 131,312,840 probably null Het
Tet1 T C 10: 62,818,983 T1574A possibly damaging Het
Tkt A T 14: 30,568,223 I270F possibly damaging Het
Tmem5 A G 10: 122,081,439 W390R probably damaging Het
Trak1 A G 9: 121,442,711 E166G probably damaging Het
Tsc2 A T 17: 24,630,965 I58N probably damaging Het
Uhmk1 T A 1: 170,215,240 M1L probably benign Het
Usp50 T C 2: 126,783,226 Y21C probably damaging Het
Vmn1r180 C G 7: 23,953,260 P283A probably damaging Het
Vmn1r83 A G 7: 12,321,578 M184T possibly damaging Het
Vmn2r109 A G 17: 20,554,403 I230T probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
R8752:Espl1 UTSW 15 102306324 missense probably damaging 1.00
R9160:Espl1 UTSW 15 102298518 missense probably damaging 1.00
R9310:Espl1 UTSW 15 102296850 critical splice donor site probably null
R9385:Espl1 UTSW 15 102298750 missense probably damaging 0.99
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTAGATGCACAGCAAATGC -3'
(R):5'- CCCGTATCAGTAACACTGGGAC -3'

Sequencing Primer
(F):5'- GCTCCCTAGTAAGATGCAGACTGTC -3'
(R):5'- TATCAGTAACACTGGGACAAGCAGTC -3'
Posted On 2019-10-17