Mutagenetix > Incidental Mutation

Incidental Mutation 'R7522:Espl1'

582753

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102305051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 604 (D604V)

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D604V

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A030014E15Rik	G	T	1: 82,925,228	C82F	unknown	Het
Adam21	G	C	12: 81,558,948	T680R	possibly damaging	Het
Adgrf4	A	C	17: 42,669,784	Y137D	probably benign	Het
Ago3	T	C	4: 126,363,807	K477R	probably benign	Het
Ahnak	T	A	19: 9,002,322	D323E	probably benign	Het
Amph	A	G	13: 19,086,545	D108G	probably damaging	Het
Ankrd10	A	T	8: 11,632,910	C106S	probably damaging	Het
Bmp5	A	T	9: 75,776,102	T4S	probably benign	Het
Brix1	G	A	15: 10,476,590	R267C	probably damaging	Het
Calcrl	G	A	2: 84,373,364	S24L	probably benign	Het
Ccdc40	T	G	11: 119,232,221	I213R	possibly damaging	Het
Cd300lg	A	G	11: 102,054,202	I413V	probably benign	Het
Cdh3	G	A	8: 106,541,373	D347N	probably damaging	Het
Clcn3	T	C	8: 60,941,412	T55A	probably benign	Het
Cnga4	A	G	7: 105,405,988	T260A	probably damaging	Het
Cpne8	G	T	15: 90,601,819	P147Q	probably benign	Het
Cpsf6	A	G	10: 117,367,829	Y74H	unknown	Het
Cryl1	A	T	14: 57,275,971	S264R	probably benign	Het
Cyp39a1	C	T	17: 43,667,479		probably benign	Het
Cyp4f39	T	C	17: 32,486,972	S346P	probably damaging	Het
Ddhd1	G	A	14: 45,657,647	A122V	possibly damaging	Het
Dnmt1	C	A	9: 20,920,202	C662F	probably damaging	Het
E2f6	G	A	12: 16,822,124	G190S	probably benign	Het
Esp34	A	T	17: 38,559,541	I109F	possibly damaging	Het
Exo1	T	C	1: 175,901,304	C645R	probably benign	Het
Fah	A	G	7: 84,597,074	V189A	probably benign	Het
Fam184b	A	C	5: 45,530,751	Y939D	probably damaging	Het
Fam49a	A	G	12: 12,358,056	T28A	possibly damaging	Het
Fchsd2	T	A	7: 101,259,622	L410*	probably null	Het
Gak	A	T	5: 108,591,199	I665N	possibly damaging	Het
Galnt9	A	G	5: 110,595,839		probably null	Het
Gcg	T	C	2: 62,475,759	R165G	probably benign	Het
Hexdc	T	C	11: 121,218,097	V214A	possibly damaging	Het
Hoxb3	A	T	11: 96,344,681	S145C	probably damaging	Het
Il18	A	G	9: 50,575,340	Y23C	probably damaging	Het
Itgav	A	T	2: 83,802,029	I954F	probably benign	Het
Kcna4	A	G	2: 107,296,255	R445G	probably damaging	Het
Kyat3	T	A	3: 142,734,544	L343Q	probably damaging	Het
Lgals4	A	T	7: 28,837,692	D139V	possibly damaging	Het
Lrp3	C	T	7: 35,204,330	G197D	probably damaging	Het
Lyst	T	A	13: 13,647,083	C1347*	probably null	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Map3k4	T	C	17: 12,261,332	Q661R	probably benign	Het
Marcks	A	C	10: 37,136,581	F153V	unknown	Het
Mocs1	T	C	17: 49,435,264		probably null	Het
Naa60	A	G	16: 3,901,904	T232A	probably benign	Het
Olfr1189	A	G	2: 88,592,661	T286A	possibly damaging	Het
Olfr453	T	A	6: 42,744,634	I199N	probably damaging	Het
Olfr700	A	G	7: 106,805,787	V225A	probably damaging	Het
Olfr845	T	A	9: 19,338,998	C179*	probably null	Het
Oosp1	A	T	19: 11,688,701	I75N	probably benign	Het
Opn3	A	G	1: 175,665,623	V125A	probably benign	Het
Palb2	T	C	7: 122,113,278	T947A	probably damaging	Het
Pde5a	C	T	3: 122,840,999	R730*	probably null	Het
Plcl1	T	C	1: 55,696,364	I288T	probably benign	Het
Plxnb2	A	G	15: 89,161,774	I966T	probably benign	Het
Prkcz	T	C	4: 155,271,285	E400G	probably damaging	Het
Prpf8	A	G	11: 75,509,276	D2332G	possibly damaging	Het
Ptgds	T	G	2: 25,467,908	T154P	probably benign	Het
Rel	T	C	11: 23,770,676		probably null	Het
Serpinb1c	T	A	13: 32,882,217	K248N	probably benign	Het
Shkbp1	A	C	7: 27,347,158	W394G	possibly damaging	Het
Slc47a2	A	G	11: 61,302,250	V559A	probably benign	Het
Sox6	A	T	7: 115,801,578	F10I	probably damaging	Het
Stkld1	T	C	2: 26,947,247	V303A	probably benign	Het
Styk1	T	A	6: 131,312,840		probably null	Het
Tet1	T	C	10: 62,818,983	T1574A	possibly damaging	Het
Tkt	A	T	14: 30,568,223	I270F	possibly damaging	Het
Tmem5	A	G	10: 122,081,439	W390R	probably damaging	Het
Trak1	A	G	9: 121,442,711	E166G	probably damaging	Het
Tsc2	A	T	17: 24,630,965	I58N	probably damaging	Het
Uhmk1	T	A	1: 170,215,240	M1L	probably benign	Het
Usp50	T	C	2: 126,783,226	Y21C	probably damaging	Het
Vmn1r180	C	G	7: 23,953,260	P283A	probably damaging	Het
Vmn1r83	A	G	7: 12,321,578	M184T	possibly damaging	Het
Vmn2r109	A	G	17: 20,554,403	I230T	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATTAGATGCACAGCAAATGC -3'
(R):5'- CCCGTATCAGTAACACTGGGAC -3'

Sequencing Primer
(F):5'- GCTCCCTAGTAAGATGCAGACTGTC -3'
(R):5'- TATCAGTAACACTGGGACAAGCAGTC -3'

Posted On

2019-10-17