Incidental Mutation 'R7522:Espl1'
ID 582753
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 045594-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7522 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102213486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 604 (D604V)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: D604V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030014E15Rik G T 1: 82,902,949 (GRCm39) C82F unknown Het
Adam21 G C 12: 81,605,722 (GRCm39) T680R possibly damaging Het
Adgrf4 A C 17: 42,980,675 (GRCm39) Y137D probably benign Het
Ago3 T C 4: 126,257,600 (GRCm39) K477R probably benign Het
Ahnak T A 19: 8,979,686 (GRCm39) D323E probably benign Het
Amph A G 13: 19,270,715 (GRCm39) D108G probably damaging Het
Ankrd10 A T 8: 11,682,910 (GRCm39) C106S probably damaging Het
Bmp5 A T 9: 75,683,384 (GRCm39) T4S probably benign Het
Brix1 G A 15: 10,476,676 (GRCm39) R267C probably damaging Het
Calcrl G A 2: 84,203,708 (GRCm39) S24L probably benign Het
Ccdc40 T G 11: 119,123,047 (GRCm39) I213R possibly damaging Het
Cd300lg A G 11: 101,945,028 (GRCm39) I413V probably benign Het
Cdh3 G A 8: 107,268,005 (GRCm39) D347N probably damaging Het
Clcn3 T C 8: 61,394,446 (GRCm39) T55A probably benign Het
Cnga4 A G 7: 105,055,195 (GRCm39) T260A probably damaging Het
Cpne8 G T 15: 90,486,022 (GRCm39) P147Q probably benign Het
Cpsf6 A G 10: 117,203,734 (GRCm39) Y74H unknown Het
Cryl1 A T 14: 57,513,428 (GRCm39) S264R probably benign Het
Cyp39a1 C T 17: 43,978,370 (GRCm39) probably benign Het
Cyp4f39 T C 17: 32,705,946 (GRCm39) S346P probably damaging Het
Cyria A G 12: 12,408,057 (GRCm39) T28A possibly damaging Het
Ddhd1 G A 14: 45,895,104 (GRCm39) A122V possibly damaging Het
Dnmt1 C A 9: 20,831,498 (GRCm39) C662F probably damaging Het
E2f6 G A 12: 16,872,125 (GRCm39) G190S probably benign Het
Esp34 A T 17: 38,870,432 (GRCm39) I109F possibly damaging Het
Exo1 T C 1: 175,728,870 (GRCm39) C645R probably benign Het
Fah A G 7: 84,246,282 (GRCm39) V189A probably benign Het
Fam184b A C 5: 45,688,093 (GRCm39) Y939D probably damaging Het
Fchsd2 T A 7: 100,908,829 (GRCm39) L410* probably null Het
Gak A T 5: 108,739,065 (GRCm39) I665N possibly damaging Het
Galnt9 A G 5: 110,743,705 (GRCm39) probably null Het
Gcg T C 2: 62,306,103 (GRCm39) R165G probably benign Het
Hexd T C 11: 121,108,923 (GRCm39) V214A possibly damaging Het
Hoxb3 A T 11: 96,235,507 (GRCm39) S145C probably damaging Het
Il18 A G 9: 50,486,640 (GRCm39) Y23C probably damaging Het
Itgav A T 2: 83,632,373 (GRCm39) I954F probably benign Het
Kcna4 A G 2: 107,126,600 (GRCm39) R445G probably damaging Het
Kyat3 T A 3: 142,440,305 (GRCm39) L343Q probably damaging Het
Lgals4 A T 7: 28,537,117 (GRCm39) D139V possibly damaging Het
Lrp3 C T 7: 34,903,755 (GRCm39) G197D probably damaging Het
Lyst T A 13: 13,821,668 (GRCm39) C1347* probably null Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Map3k4 T C 17: 12,480,219 (GRCm39) Q661R probably benign Het
Marcks A C 10: 37,012,577 (GRCm39) F153V unknown Het
Mocs1 T C 17: 49,742,292 (GRCm39) probably null Het
Naa60 A G 16: 3,719,768 (GRCm39) T232A probably benign Het
Oosp1 A T 19: 11,666,065 (GRCm39) I75N probably benign Het
Opn3 A G 1: 175,493,189 (GRCm39) V125A probably benign Het
Or2ag18 A G 7: 106,404,994 (GRCm39) V225A probably damaging Het
Or2f1 T A 6: 42,721,568 (GRCm39) I199N probably damaging Het
Or4c102 A G 2: 88,423,005 (GRCm39) T286A possibly damaging Het
Or7g27 T A 9: 19,250,294 (GRCm39) C179* probably null Het
Palb2 T C 7: 121,712,501 (GRCm39) T947A probably damaging Het
Pde5a C T 3: 122,634,648 (GRCm39) R730* probably null Het
Plcl1 T C 1: 55,735,523 (GRCm39) I288T probably benign Het
Plxnb2 A G 15: 89,045,977 (GRCm39) I966T probably benign Het
Prkcz T C 4: 155,355,742 (GRCm39) E400G probably damaging Het
Prpf8 A G 11: 75,400,102 (GRCm39) D2332G possibly damaging Het
Ptgds T G 2: 25,357,920 (GRCm39) T154P probably benign Het
Rel T C 11: 23,720,676 (GRCm39) probably null Het
Rxylt1 A G 10: 121,917,344 (GRCm39) W390R probably damaging Het
Serpinb1c T A 13: 33,066,200 (GRCm39) K248N probably benign Het
Shkbp1 A C 7: 27,046,583 (GRCm39) W394G possibly damaging Het
Slc47a2 A G 11: 61,193,076 (GRCm39) V559A probably benign Het
Sox6 A T 7: 115,400,813 (GRCm39) F10I probably damaging Het
Stkld1 T C 2: 26,837,259 (GRCm39) V303A probably benign Het
Styk1 T A 6: 131,289,803 (GRCm39) probably null Het
Tet1 T C 10: 62,654,762 (GRCm39) T1574A possibly damaging Het
Tkt A T 14: 30,290,180 (GRCm39) I270F possibly damaging Het
Trak1 A G 9: 121,271,777 (GRCm39) E166G probably damaging Het
Tsc2 A T 17: 24,849,939 (GRCm39) I58N probably damaging Het
Uhmk1 T A 1: 170,042,809 (GRCm39) M1L probably benign Het
Usp50 T C 2: 126,625,146 (GRCm39) Y21C probably damaging Het
Vmn1r180 C G 7: 23,652,685 (GRCm39) P283A probably damaging Het
Vmn1r83 A G 7: 12,055,505 (GRCm39) M184T possibly damaging Het
Vmn2r109 A G 17: 20,774,665 (GRCm39) I230T probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTAGATGCACAGCAAATGC -3'
(R):5'- CCCGTATCAGTAACACTGGGAC -3'

Sequencing Primer
(F):5'- GCTCCCTAGTAAGATGCAGACTGTC -3'
(R):5'- TATCAGTAACACTGGGACAAGCAGTC -3'
Posted On 2019-10-17