Incidental Mutation 'R7522:Cyp4f39'
ID582758
Institutional Source Beutler Lab
Gene Symbol Cyp4f39
Ensembl Gene ENSMUSG00000061126
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms4732474A20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177307; MGI: 2445210

Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7522 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32468462-32492479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32486972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 346 (S346P)
Ref Sequence ENSEMBL: ENSMUSP00000003413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003413]
Predicted Effect probably damaging
Transcript: ENSMUST00000003413
AA Change: S346P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003413
Gene: ENSMUSG00000061126
AA Change: S346P

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
Pfam:p450 60 525 5.8e-124 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030014E15Rik G T 1: 82,925,228 C82F unknown Het
Adam21 G C 12: 81,558,948 T680R possibly damaging Het
Adgrf4 A C 17: 42,669,784 Y137D probably benign Het
Ago3 T C 4: 126,363,807 K477R probably benign Het
Ahnak T A 19: 9,002,322 D323E probably benign Het
Amph A G 13: 19,086,545 D108G probably damaging Het
Ankrd10 A T 8: 11,632,910 C106S probably damaging Het
Bmp5 A T 9: 75,776,102 T4S probably benign Het
Brix1 G A 15: 10,476,590 R267C probably damaging Het
Calcrl G A 2: 84,373,364 S24L probably benign Het
Ccdc40 T G 11: 119,232,221 I213R possibly damaging Het
Cd300lg A G 11: 102,054,202 I413V probably benign Het
Cdh3 G A 8: 106,541,373 D347N probably damaging Het
Clcn3 T C 8: 60,941,412 T55A probably benign Het
Cnga4 A G 7: 105,405,988 T260A probably damaging Het
Cpne8 G T 15: 90,601,819 P147Q probably benign Het
Cpsf6 A G 10: 117,367,829 Y74H unknown Het
Cryl1 A T 14: 57,275,971 S264R probably benign Het
Cyp39a1 C T 17: 43,667,479 probably benign Het
Ddhd1 G A 14: 45,657,647 A122V possibly damaging Het
Dnmt1 C A 9: 20,920,202 C662F probably damaging Het
E2f6 G A 12: 16,822,124 G190S probably benign Het
Esp34 A T 17: 38,559,541 I109F possibly damaging Het
Espl1 A T 15: 102,305,051 D604V probably damaging Het
Exo1 T C 1: 175,901,304 C645R probably benign Het
Fah A G 7: 84,597,074 V189A probably benign Het
Fam184b A C 5: 45,530,751 Y939D probably damaging Het
Fam49a A G 12: 12,358,056 T28A possibly damaging Het
Fchsd2 T A 7: 101,259,622 L410* probably null Het
Gak A T 5: 108,591,199 I665N possibly damaging Het
Galnt9 A G 5: 110,595,839 probably null Het
Gcg T C 2: 62,475,759 R165G probably benign Het
Hexdc T C 11: 121,218,097 V214A possibly damaging Het
Hoxb3 A T 11: 96,344,681 S145C probably damaging Het
Il18 A G 9: 50,575,340 Y23C probably damaging Het
Itgav A T 2: 83,802,029 I954F probably benign Het
Kcna4 A G 2: 107,296,255 R445G probably damaging Het
Kyat3 T A 3: 142,734,544 L343Q probably damaging Het
Lgals4 A T 7: 28,837,692 D139V possibly damaging Het
Lrp3 C T 7: 35,204,330 G197D probably damaging Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k4 T C 17: 12,261,332 Q661R probably benign Het
Marcks A C 10: 37,136,581 F153V unknown Het
Mocs1 T C 17: 49,435,264 probably null Het
Naa60 A G 16: 3,901,904 T232A probably benign Het
Olfr1189 A G 2: 88,592,661 T286A possibly damaging Het
Olfr453 T A 6: 42,744,634 I199N probably damaging Het
Olfr700 A G 7: 106,805,787 V225A probably damaging Het
Olfr845 T A 9: 19,338,998 C179* probably null Het
Oosp1 A T 19: 11,688,701 I75N probably benign Het
Opn3 A G 1: 175,665,623 V125A probably benign Het
Palb2 T C 7: 122,113,278 T947A probably damaging Het
Pde5a C T 3: 122,840,999 R730* probably null Het
Plcl1 T C 1: 55,696,364 I288T probably benign Het
Plxnb2 A G 15: 89,161,774 I966T probably benign Het
Prkcz T C 4: 155,271,285 E400G probably damaging Het
Prpf8 A G 11: 75,509,276 D2332G possibly damaging Het
Ptgds T G 2: 25,467,908 T154P probably benign Het
Rel T C 11: 23,770,676 probably null Het
Serpinb1c T A 13: 32,882,217 K248N probably benign Het
Shkbp1 A C 7: 27,347,158 W394G possibly damaging Het
Slc47a2 A G 11: 61,302,250 V559A probably benign Het
Sox6 A T 7: 115,801,578 F10I probably damaging Het
Stkld1 T C 2: 26,947,247 V303A probably benign Het
Styk1 T A 6: 131,312,840 probably null Het
Tet1 T C 10: 62,818,983 T1574A possibly damaging Het
Tkt A T 14: 30,568,223 I270F possibly damaging Het
Tmem5 A G 10: 122,081,439 W390R probably damaging Het
Trak1 A G 9: 121,442,711 E166G probably damaging Het
Tsc2 A T 17: 24,630,965 I58N probably damaging Het
Uhmk1 T A 1: 170,215,240 M1L probably benign Het
Usp50 T C 2: 126,783,226 Y21C probably damaging Het
Vmn1r180 C G 7: 23,953,260 P283A probably damaging Het
Vmn1r83 A G 7: 12,321,578 M184T possibly damaging Het
Vmn2r109 A G 17: 20,554,403 I230T probably benign Het
Other mutations in Cyp4f39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cyp4f39 APN 17 32470912 missense probably damaging 1.00
IGL00822:Cyp4f39 APN 17 32470832 missense probably benign 0.03
IGL00857:Cyp4f39 APN 17 32489657 missense probably benign 0.08
IGL01380:Cyp4f39 APN 17 32481858 missense probably damaging 1.00
IGL01532:Cyp4f39 APN 17 32470954 splice site probably benign
IGL01756:Cyp4f39 APN 17 32483441 nonsense probably null
IGL02090:Cyp4f39 APN 17 32470958 splice site probably benign
IGL02477:Cyp4f39 APN 17 32489645 missense probably benign 0.40
IGL02824:Cyp4f39 APN 17 32468685 critical splice donor site probably null
N/A:Cyp4f39 UTSW 17 32468681 missense probably benign 0.03
R0145:Cyp4f39 UTSW 17 32486960 missense possibly damaging 0.92
R0288:Cyp4f39 UTSW 17 32492436 missense probably benign 0.01
R1676:Cyp4f39 UTSW 17 32482202 missense probably benign 0.41
R1677:Cyp4f39 UTSW 17 32492330 missense probably benign 0.30
R1874:Cyp4f39 UTSW 17 32483324 missense probably damaging 1.00
R1920:Cyp4f39 UTSW 17 32483291 missense probably benign 0.00
R2049:Cyp4f39 UTSW 17 32482138 missense probably benign 0.41
R2139:Cyp4f39 UTSW 17 32491189 missense probably benign 0.01
R2212:Cyp4f39 UTSW 17 32487063 missense possibly damaging 0.62
R3416:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R3417:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R4486:Cyp4f39 UTSW 17 32483454 missense probably damaging 1.00
R5023:Cyp4f39 UTSW 17 32481104 missense probably damaging 1.00
R5523:Cyp4f39 UTSW 17 32470833 missense probably benign 0.10
R5714:Cyp4f39 UTSW 17 32481825 missense probably damaging 1.00
R6010:Cyp4f39 UTSW 17 32482186 missense probably damaging 0.99
R6312:Cyp4f39 UTSW 17 32483294 missense probably benign 0.00
R6477:Cyp4f39 UTSW 17 32481817 missense probably damaging 0.99
R6950:Cyp4f39 UTSW 17 32492306 missense probably damaging 1.00
R7228:Cyp4f39 UTSW 17 32491829 missense probably damaging 1.00
R7311:Cyp4f39 UTSW 17 32489655 missense probably damaging 1.00
R7341:Cyp4f39 UTSW 17 32486954 missense probably damaging 1.00
R7345:Cyp4f39 UTSW 17 32486779 missense probably damaging 1.00
R7405:Cyp4f39 UTSW 17 32481815 missense probably benign 0.01
R7842:Cyp4f39 UTSW 17 32483317 missense probably benign 0.01
R7925:Cyp4f39 UTSW 17 32483317 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCTGACGAGGACATCCGG -3'
(R):5'- TTGTCCTGGAAACTGCTGAAC -3'

Sequencing Primer
(F):5'- GGCCGAGGCAGATACTTTCATG -3'
(R):5'- TGCAGGGACTTGTCTAAGACCAC -3'
Posted On2019-10-17