Incidental Mutation 'R7523:Olfr1045'
ID582768
Institutional Source Beutler Lab
Gene Symbol Olfr1045
Ensembl Gene ENSMUSG00000075198
Gene Nameolfactory receptor 1045
SynonymsMOR185-2, GA_x6K02T2Q125-47672825-47671878
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86195910-86203009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86198045 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 236 (K236E)
Ref Sequence ENSEMBL: ENSMUSP00000148982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099904] [ENSMUST00000215763]
Predicted Effect probably damaging
Transcript: ENSMUST00000099904
AA Change: K236E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097488
Gene: ENSMUSG00000075198
AA Change: K236E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-43 PFAM
Pfam:7tm_1 41 290 5.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215763
AA Change: K236E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Olfr1045
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr1045 APN 2 86197805 makesense probably null
IGL01914:Olfr1045 APN 2 86198672 missense probably benign 0.45
IGL01991:Olfr1045 APN 2 86198533 missense probably benign 0.23
IGL02623:Olfr1045 APN 2 86198019 missense probably damaging 1.00
R0325:Olfr1045 UTSW 2 86198711 missense possibly damaging 0.51
R0730:Olfr1045 UTSW 2 86198725 missense probably benign 0.14
R1457:Olfr1045 UTSW 2 86198252 missense probably damaging 0.99
R2037:Olfr1045 UTSW 2 86197832 missense probably benign
R2121:Olfr1045 UTSW 2 86197996 missense possibly damaging 0.88
R2271:Olfr1045 UTSW 2 86197817 missense probably benign 0.00
R3836:Olfr1045 UTSW 2 86198662 missense probably benign 0.02
R4669:Olfr1045 UTSW 2 86197933 missense possibly damaging 0.90
R6082:Olfr1045 UTSW 2 86198317 missense probably damaging 0.97
R7326:Olfr1045 UTSW 2 86198573 missense probably damaging 1.00
R7463:Olfr1045 UTSW 2 86197838 missense probably benign
R7842:Olfr1045 UTSW 2 86198172 nonsense probably null
R7919:Olfr1045 UTSW 2 86198265 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGGCTGTAGATCATGGG -3'
(R):5'- TGCACAGCCATTGTCGTTTC -3'

Sequencing Primer
(F):5'- GGTTCAGCATTGGGATGACC -3'
(R):5'- ACCATTTTTACTGTGATAATGTCCC -3'
Posted On2019-10-17