Mutagenetix > Incidental Mutations

Incidental Mutation 'R7523:Rtel1'

582770

Institutional Source

Beutler Lab

Gene Symbol

Rtel1

Ensembl Gene

ENSMUSG00000038685

Gene Name

regulator of telomere elongation helicase 1

Synonyms

Nhl, Rtel, KIAA1088, C20ORF41

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7523 (G1)

Quality Score

208.009

Status

Validated

Chromosome

Chromosomal Location

181319739-181356616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 181322315 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 36 (V36M)

Ref Sequence

ENSEMBL: ENSMUSP00000053120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000153112]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048608
AA Change: V36M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000054622
AA Change: V36M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1075	1092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098971
AA Change: V36M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1036	1053	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108814
AA Change: V36M

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1069	1086	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108815
AA Change: V36M

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
DEXDc	13	292	9.88e-3	SMART
HELICc	563	717	1.07e-62	SMART
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153112
AA Change: V36M

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118810
Gene: ENSMUSG00000038685
AA Change: V36M

Domain	Start	End	E-Value	Type
Pfam:ResIII	14	101	1.8e-7	PFAM
Pfam:DEAD_2	111	161	3.3e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	A	2: 68,662,480	H40Q	unknown	Het
4932414N04Rik	A	T	2: 68,739,329	Q463L	probably benign	Het
Ano4	C	A	10: 88,971,395	E775*	probably null	Het
Atp12a	T	C	14: 56,365,968	V10A	possibly damaging	Het
Camkmt	A	G	17: 85,391,628	I144M	probably benign	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dazl	G	A	17: 50,287,541	T162I	probably damaging	Het
Dnah10	A	G	5: 124,747,739	K653R	probably damaging	Het
Exosc10	A	T	4: 148,563,842		probably null	Het
Fam96b	G	A	8: 104,641,772		probably benign	Het
Fbn2	T	C	18: 58,066,080	D1372G	probably benign	Het
Fxr1	T	C	3: 34,039,543	V23A	probably benign	Het
Gmps	T	C	3: 64,011,666	I557T	possibly damaging	Het
Ifnab	A	T	4: 88,690,792	Y146N	probably damaging	Het
Krt78	T	C	15: 101,946,601	Y925C	not run	Het
Lrp1b	C	T	2: 41,511,461	V394M		Het
Ltbp2	T	C	12: 84,791,034	T1211A	probably benign	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mdn1	A	T	4: 32,667,270		probably null	Het
Myo15b	A	T	11: 115,890,858	I2798F	unknown	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nectin2	A	G	7: 19,730,112	V314A	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nfx1	A	G	4: 41,016,119	I894V	probably benign	Het
Olfr1045	T	C	2: 86,198,045	K236E	probably damaging	Het
Olfr15	T	C	16: 3,839,699	V242A	probably benign	Het
Pdcd4	G	T	19: 53,910,948	V123F	probably damaging	Het
Pik3c3	C	T	18: 30,293,655	R275W	probably damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Ptbp3	A	G	4: 59,546,159	V11A	probably benign	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Ptprg	T	G	14: 12,237,130	I1383S	probably damaging	Het
Sf3b3	A	G	8: 110,813,720	I1023T	probably benign	Het
Slc44a2	A	G	9: 21,345,992	E411G	probably null	Het
Stard9	T	C	2: 120,699,597	Y2112H	probably benign	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tenm2	A	T	11: 36,078,581		probably null	Het
Tle1	A	T	4: 72,145,418	S199R	possibly damaging	Het
Tubgcp2	A	G	7: 140,006,870	I399T	probably benign	Het
Ubr5	T	C	15: 38,004,055	N1344S		Het
Vmn2r114	A	G	17: 23,310,637	F164L	probably benign	Het
Vps13a	G	T	19: 16,703,789	T1041K	probably benign	Het
Zbtb20	T	C	16: 43,610,512	V389A	probably benign	Het
Zfp811	A	T	17: 32,797,752	I438N	probably benign	Het
Zfp90	A	G	8: 106,423,913	D86G	probably benign	Het

Other mutations in Rtel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Rtel1	APN	2	181354401	missense	probably benign	0.16
IGL01957:Rtel1	APN	2	181349313	unclassified	probably benign
IGL02247:Rtel1	APN	2	181351341	nonsense	probably null
IGL02414:Rtel1	APN	2	181335972	missense	probably benign	0.01
IGL02448:Rtel1	APN	2	181336037	missense	probably benign	0.00
IGL03053:Rtel1	APN	2	181351944	missense	probably benign	0.02
IGL03059:Rtel1	APN	2	181350183	missense	probably benign	0.01
IGL03326:Rtel1	APN	2	181355561	unclassified	probably benign
PIT4283001:Rtel1	UTSW	2	181346890	missense	probably benign	0.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0047:Rtel1	UTSW	2	181323405	missense	probably damaging	1.00
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0051:Rtel1	UTSW	2	181350656	nonsense	probably null
R0147:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0148:Rtel1	UTSW	2	181321046	missense	probably damaging	1.00
R0316:Rtel1	UTSW	2	181356002	missense	possibly damaging	0.87
R0628:Rtel1	UTSW	2	181351881	missense	probably benign	0.03
R0940:Rtel1	UTSW	2	181322803	missense	probably benign	0.36
R1165:Rtel1	UTSW	2	181334939	missense	probably benign	0.26
R1213:Rtel1	UTSW	2	181351335	missense	probably benign	0.01
R1291:Rtel1	UTSW	2	181351043	missense	probably damaging	1.00
R1353:Rtel1	UTSW	2	181349231	missense	probably benign
R1398:Rtel1	UTSW	2	181335865	intron	probably null
R1796:Rtel1	UTSW	2	181352103	missense	probably benign	0.01
R1973:Rtel1	UTSW	2	181351626	missense	probably benign	0.04
R2033:Rtel1	UTSW	2	181351863	nonsense	probably null
R2144:Rtel1	UTSW	2	181323706	missense	probably damaging	0.97
R2265:Rtel1	UTSW	2	181354368	missense	probably damaging	1.00
R2269:Rtel1	UTSW	2	181336003	missense	probably benign	0.00
R2416:Rtel1	UTSW	2	181340531	missense	possibly damaging	0.66
R2865:Rtel1	UTSW	2	181349972	missense	probably benign	0.36
R3508:Rtel1	UTSW	2	181322409	missense	probably benign	0.32
R4242:Rtel1	UTSW	2	181349934	missense	probably damaging	1.00
R4377:Rtel1	UTSW	2	181355796	missense	probably damaging	1.00
R4702:Rtel1	UTSW	2	181352169	missense	probably benign	0.30
R4706:Rtel1	UTSW	2	181323746	critical splice donor site	probably null
R4817:Rtel1	UTSW	2	181355935	missense	possibly damaging	0.82
R5020:Rtel1	UTSW	2	181322514	splice site	probably null
R5069:Rtel1	UTSW	2	181355492	missense	probably benign	0.03
R5222:Rtel1	UTSW	2	181346983	intron	probably benign
R5268:Rtel1	UTSW	2	181340561	missense	probably benign	0.03
R5291:Rtel1	UTSW	2	181352095	missense	possibly damaging	0.47
R5588:Rtel1	UTSW	2	181352100	missense	probably benign
R5682:Rtel1	UTSW	2	181349972	missense	probably benign	0.19
R5796:Rtel1	UTSW	2	181340506	missense	probably benign	0.26
R5931:Rtel1	UTSW	2	181330815	nonsense	probably null
R6249:Rtel1	UTSW	2	181351682	missense	probably damaging	1.00
R6465:Rtel1	UTSW	2	181335940	missense	possibly damaging	0.68
R6616:Rtel1	UTSW	2	181352786	missense	possibly damaging	0.68
R6800:Rtel1	UTSW	2	181322463	missense	probably benign	0.31
R6835:Rtel1	UTSW	2	181355953	missense	probably benign	0.04
R6917:Rtel1	UTSW	2	181338277	makesense	probably null
R7264:Rtel1	UTSW	2	181351861	missense	not run
R7381:Rtel1	UTSW	2	181330815	nonsense	probably null
R7587:Rtel1	UTSW	2	181322315	missense	probably damaging	1.00
R7681:Rtel1	UTSW	2	181322394	missense	probably damaging	0.99
R7871:Rtel1	UTSW	2	181321029	missense	probably damaging	1.00
R7912:Rtel1	UTSW	2	181356076	missense	possibly damaging	0.56
R7954:Rtel1	UTSW	2	181321029	missense	probably damaging	1.00
R7993:Rtel1	UTSW	2	181356076	missense	possibly damaging	0.56
R8007:Rtel1	UTSW	2	181334974	missense	not run
R8062:Rtel1	UTSW	2	181340567	missense	not run

Predicted Primers

PCR Primer
(F):5'- TAGCACCTGATTAGTCATCTGAC -3'
(R):5'- CACCTATTGAGTCTCCGCTG -3'

Sequencing Primer
(F):5'- ACTTACTATGTAGACCAGCCTGG -3'
(R):5'- GAAACTGCATCTCGGAGA -3'

Posted On

2019-10-17