Incidental Mutation 'R7523:Rtel1'
ID582770
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7523 (G1)
Quality Score208.009
Status Validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181322315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 36 (V36M)
Ref Sequence ENSEMBL: ENSMUSP00000053120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000153112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048608
AA Change: V36M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054622
AA Change: V36M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098971
AA Change: V36M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108814
AA Change: V36M

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108815
AA Change: V36M

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153112
AA Change: V36M

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118810
Gene: ENSMUSG00000038685
AA Change: V36M

DomainStartEndE-ValueType
Pfam:ResIII 14 101 1.8e-7 PFAM
Pfam:DEAD_2 111 161 3.3e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R7954:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7993:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense not run
R8062:Rtel1 UTSW 2 181340567 missense not run
Predicted Primers PCR Primer
(F):5'- TAGCACCTGATTAGTCATCTGAC -3'
(R):5'- CACCTATTGAGTCTCCGCTG -3'

Sequencing Primer
(F):5'- ACTTACTATGTAGACCAGCCTGG -3'
(R):5'- GAAACTGCATCTCGGAGA -3'
Posted On2019-10-17