Incidental Mutation 'R7523:Fxr1'
ID582771
Institutional Source Beutler Lab
Gene Symbol Fxr1
Ensembl Gene ENSMUSG00000027680
Gene Namefragile X mental retardation gene 1, autosomal homolog
Synonyms9530073J07Rik, Fxr1p, Fxr1h, 1110050J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location34019943-34070322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34039543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000143392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001620] [ENSMUST00000167354] [ENSMUST00000197694] [ENSMUST00000198051] [ENSMUST00000200086] [ENSMUST00000200392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001620
AA Change: V23A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001620
Gene: ENSMUSG00000027680
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Agenet 2 55 4.4e-7 PFAM
Pfam:Agenet 62 120 7.1e-10 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
low complexity region 404 421 N/A INTRINSIC
Pfam:FXR_C1 489 564 1.9e-41 PFAM
low complexity region 572 582 N/A INTRINSIC
Pfam:FXR_C3 610 676 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167354
SMART Domains Protein: ENSMUSP00000130216
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197694
AA Change: V23A

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142441
Gene: ENSMUSG00000027680
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.9e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 5e-9 PFAM
Pfam:FXR1P_C 379 486 1.8e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000198051
AA Change: V23A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142847
Gene: ENSMUSG00000027680
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Agenet 59 120 1.2e-11 PFAM
KH 217 284 2.2e-6 SMART
KH 286 356 7.5e-5 SMART
Pfam:FXR1P_C 361 515 1.6e-64 PFAM
low complexity region 531 539 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200086
AA Change: V23A
SMART Domains Protein: ENSMUSP00000143562
Gene: ENSMUSG00000027680
AA Change: V23A

DomainStartEndE-ValueType
PDB:3O8V|A 2 40 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200392
AA Change: V23A

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143392
Gene: ENSMUSG00000027680
AA Change: V23A

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Meta Mutation Damage Score 0.4970 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Fxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Fxr1 APN 3 34047627 splice site probably benign
IGL01598:Fxr1 APN 3 34064232 missense possibly damaging 0.61
Outer_limits UTSW 3 34039543 missense probably benign 0.30
pueblo UTSW 3 34064232 missense possibly damaging 0.61
R1294:Fxr1 UTSW 3 34047052 missense probably benign 0.00
R2134:Fxr1 UTSW 3 34058047 missense probably damaging 1.00
R2405:Fxr1 UTSW 3 34061854 missense probably damaging 1.00
R3023:Fxr1 UTSW 3 34064224 missense probably damaging 1.00
R3055:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R3056:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R4009:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4010:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4706:Fxr1 UTSW 3 34064129 missense probably damaging 0.99
R4721:Fxr1 UTSW 3 34064232 missense possibly damaging 0.61
R4877:Fxr1 UTSW 3 34047698 missense probably damaging 0.99
R5583:Fxr1 UTSW 3 34068976 missense probably benign 0.18
R6280:Fxr1 UTSW 3 34046252 intron probably benign
R6801:Fxr1 UTSW 3 34054303 missense possibly damaging 0.65
R7203:Fxr1 UTSW 3 34046540 missense possibly damaging 0.76
R7422:Fxr1 UTSW 3 34049220 missense probably damaging 1.00
R7785:Fxr1 UTSW 3 34046254 missense
R8195:Fxr1 UTSW 3 34047729 missense probably damaging 1.00
R8250:Fxr1 UTSW 3 34047029 nonsense probably null
X0067:Fxr1 UTSW 3 34046044 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGTGTCTGTCTTTGTCTGTCCT -3'
(R):5'- ACTTGTGCATCTACTTCTGCA -3'

Sequencing Primer
(F):5'- GGAGGCAAGTATTCTACCAACTTAGC -3'
(R):5'- GCTGCTTACTGAATCATATCCATAC -3'
Posted On2019-10-17