Incidental Mutation 'R7523:Nexn'
ID582774
Institutional Source Beutler Lab
Gene Symbol Nexn
Ensembl Gene ENSMUSG00000039103
Gene Namenexilin
Synonyms1110046H09Rik, nF actin binding protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R7523 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location152236982-152266350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152247178 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 316 (R316G)
Ref Sequence ENSEMBL: ENSMUSP00000142936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000196504] [ENSMUST00000196815] [ENSMUST00000198460] [ENSMUST00000198648] [ENSMUST00000198750] [ENSMUST00000199423] [ENSMUST00000199470] [ENSMUST00000199685] [ENSMUST00000200589]
Predicted Effect probably benign
Transcript: ENSMUST00000046045
AA Change: R252G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103
AA Change: R252G

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196504
SMART Domains Protein: ENSMUSP00000143180
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000196815
Predicted Effect probably benign
Transcript: ENSMUST00000198460
SMART Domains Protein: ENSMUSP00000143573
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
internal_repeat_1 14 35 1.01e-5 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 1.01e-5 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 345 N/A INTRINSIC
coiled coil region 378 406 N/A INTRINSIC
coiled coil region 429 480 N/A INTRINSIC
IG 506 590 2.1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198648
SMART Domains Protein: ENSMUSP00000143294
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198750
AA Change: R238G
SMART Domains Protein: ENSMUSP00000142574
Gene: ENSMUSG00000039103
AA Change: R238G

DomainStartEndE-ValueType
coiled coil region 40 86 N/A INTRINSIC
coiled coil region 162 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199423
AA Change: R316G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142936
Gene: ENSMUSG00000039103
AA Change: R316G

DomainStartEndE-ValueType
internal_repeat_1 14 35 4.74e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 4.74e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 240 422 N/A INTRINSIC
coiled coil region 455 483 N/A INTRINSIC
coiled coil region 506 557 N/A INTRINSIC
IG 583 667 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199470
AA Change: R182G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103
AA Change: R182G

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199685
SMART Domains Protein: ENSMUSP00000142569
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200589
AA Change: R302G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142559
Gene: ENSMUSG00000039103
AA Change: R302G

DomainStartEndE-ValueType
internal_repeat_1 14 35 8.44e-7 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 8.44e-7 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality with endomyocardial fibroelastosis, cardiac hypertrophy and dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Nexn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Nexn APN 3 152247233 missense probably benign 0.00
IGL01681:Nexn APN 3 152243870 missense possibly damaging 0.86
IGL02098:Nexn APN 3 152243903 nonsense probably null
IGL02146:Nexn APN 3 152247248 missense probably benign 0.01
IGL02151:Nexn APN 3 152248244 missense probably damaging 0.99
R0369:Nexn UTSW 3 152248257 missense probably benign 0.40
R0540:Nexn UTSW 3 152248242 nonsense probably null
R1501:Nexn UTSW 3 152237686 missense possibly damaging 0.91
R1828:Nexn UTSW 3 152242768 missense probably damaging 1.00
R1903:Nexn UTSW 3 152248181 missense probably damaging 0.99
R1990:Nexn UTSW 3 152252939 missense probably damaging 1.00
R2857:Nexn UTSW 3 152248043 missense probably damaging 1.00
R2858:Nexn UTSW 3 152248043 missense probably damaging 1.00
R4482:Nexn UTSW 3 152242753 missense probably damaging 0.99
R4593:Nexn UTSW 3 152252916 missense probably damaging 1.00
R4750:Nexn UTSW 3 152237722 missense probably damaging 1.00
R5113:Nexn UTSW 3 152243888 missense probably damaging 1.00
R5252:Nexn UTSW 3 152237953 missense probably benign 0.01
R5289:Nexn UTSW 3 152248072 missense probably benign 0.13
R5502:Nexn UTSW 3 152238304 missense probably damaging 1.00
R5746:Nexn UTSW 3 152242876 unclassified probably benign
R6230:Nexn UTSW 3 152238275 missense probably damaging 1.00
R7251:Nexn UTSW 3 152247195 missense probably damaging 0.96
R7571:Nexn UTSW 3 152253647 missense possibly damaging 0.80
R7587:Nexn UTSW 3 152247178 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCCTAGCTTGGGCAAGTACAC -3'
(R):5'- CCAGAAGGAACTGAAGTATTCTGGG -3'

Sequencing Primer
(F):5'- TAGCTTGGGCAAGTACACATACC -3'
(R):5'- GTCTAGTTGCTAGCCACATACC -3'
Posted On2019-10-17