Mutagenetix > Incidental Mutations

Incidental Mutation 'R7523:Nfx1'

582776

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.580) question?

Stock #

R7523 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41016119 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 894 (I894V)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

Predicted Effect

probably benign
Transcript: ENSMUST00000030133

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091614

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098143
AA Change: I894V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: I894V

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124595

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143798

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	A	2: 68,662,480	H40Q	unknown	Het
4932414N04Rik	A	T	2: 68,739,329	Q463L	probably benign	Het
Ano4	C	A	10: 88,971,395	E775*	probably null	Het
Atp12a	T	C	14: 56,365,968	V10A	possibly damaging	Het
Camkmt	A	G	17: 85,391,628	I144M	probably benign	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dazl	G	A	17: 50,287,541	T162I	probably damaging	Het
Dnah10	A	G	5: 124,747,739	K653R	probably damaging	Het
Exosc10	A	T	4: 148,563,842		probably null	Het
Fam96b	G	A	8: 104,641,772		probably benign	Het
Fbn2	T	C	18: 58,066,080	D1372G	probably benign	Het
Fxr1	T	C	3: 34,039,543	V23A	probably benign	Het
Gmps	T	C	3: 64,011,666	I557T	possibly damaging	Het
Ifnab	A	T	4: 88,690,792	Y146N	probably damaging	Het
Krt78	T	C	15: 101,946,601	Y925C	not run	Het
Lrp1b	C	T	2: 41,511,461	V394M		Het
Ltbp2	T	C	12: 84,791,034	T1211A	probably benign	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mdn1	A	T	4: 32,667,270		probably null	Het
Myo15b	A	T	11: 115,890,858	I2798F	unknown	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nectin2	A	G	7: 19,730,112	V314A	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Olfr1045	T	C	2: 86,198,045	K236E	probably damaging	Het
Olfr15	T	C	16: 3,839,699	V242A	probably benign	Het
Pdcd4	G	T	19: 53,910,948	V123F	probably damaging	Het
Pik3c3	C	T	18: 30,293,655	R275W	probably damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Ptbp3	A	G	4: 59,546,159	V11A	probably benign	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Ptprg	T	G	14: 12,237,130	I1383S	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Sf3b3	A	G	8: 110,813,720	I1023T	probably benign	Het
Slc44a2	A	G	9: 21,345,992	E411G	probably null	Het
Stard9	T	C	2: 120,699,597	Y2112H	probably benign	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tenm2	A	T	11: 36,078,581		probably null	Het
Tle1	A	T	4: 72,145,418	S199R	possibly damaging	Het
Tubgcp2	A	G	7: 140,006,870	I399T	probably benign	Het
Ubr5	T	C	15: 38,004,055	N1344S		Het
Vmn2r114	A	G	17: 23,310,637	F164L	probably benign	Het
Vps13a	G	T	19: 16,703,789	T1041K	probably benign	Het
Zbtb20	T	C	16: 43,610,512	V389A	probably benign	Het
Zfp811	A	T	17: 32,797,752	I438N	probably benign	Het
Zfp90	A	G	8: 106,423,913	D86G	probably benign	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGACCAAGACATGCGCCTC -3'
(R):5'- CAACCTCCTCGGGCTGGA -3'

Sequencing Primer
(F):5'- AACGTGCCCATTGCTGTG -3'
(R):5'- CTGGAGACATAGCTCAGTGGC -3'

Posted On

2019-10-17