Incidental Mutation 'R7523:Nectin2'
ID582783
Institutional Source Beutler Lab
Gene Symbol Nectin2
Ensembl Gene ENSMUSG00000062300
Gene Namenectin cell adhesion molecule 2
SynonymsMPH, nectin-2, Cd112, Pvs, Pvrl2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7523 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19716644-19750483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19730112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 314 (V314A)
Ref Sequence ENSEMBL: ENSMUSP00000074898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075447] [ENSMUST00000108450]
PDB Structure
Crystal structure of mouse nectin-2 extracellular fragment D1-D2 [X-RAY DIFFRACTION]
Crystal structure of mouse nectin-2 extracellular fragment D1-D2, 2nd crystal form [X-RAY DIFFRACTION]
Crystal structure of mutant F136D of mouse nectin-2 extracellular fragment D1-D2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000075447
AA Change: V314A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300
AA Change: V314A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108450
AA Change: V314A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104089
Gene: ENSMUSG00000062300
AA Change: V314A

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations exhibit male sterility associated with sperm head and midpiece malformation, impaired zona binding, and lack of oocyte penetration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Nectin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Nectin2 APN 7 19717562 missense probably damaging 1.00
IGL03184:Nectin2 APN 7 19738306 missense possibly damaging 0.86
PIT4458001:Nectin2 UTSW 7 19738327 missense probably benign 0.19
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0555:Nectin2 UTSW 7 19733223 splice site probably benign
R0764:Nectin2 UTSW 7 19749171 intron probably null
R1252:Nectin2 UTSW 7 19717598 missense probably benign 0.18
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1833:Nectin2 UTSW 7 19717708 missense probably damaging 0.96
R2115:Nectin2 UTSW 7 19717564 missense probably damaging 0.98
R2168:Nectin2 UTSW 7 19730614 missense probably damaging 0.98
R3801:Nectin2 UTSW 7 19717636 missense probably benign
R3825:Nectin2 UTSW 7 19724585 missense possibly damaging 0.94
R4877:Nectin2 UTSW 7 19717720 missense possibly damaging 0.55
R5062:Nectin2 UTSW 7 19738273 missense probably benign 0.09
R5082:Nectin2 UTSW 7 19738124 missense probably damaging 0.99
R5693:Nectin2 UTSW 7 19724869 missense probably benign 0.00
R6042:Nectin2 UTSW 7 19738138 missense probably benign 0.01
R6060:Nectin2 UTSW 7 19717775 missense probably damaging 1.00
R6657:Nectin2 UTSW 7 19738140 missense probably benign 0.41
R7437:Nectin2 UTSW 7 19749268 nonsense probably null
R7476:Nectin2 UTSW 7 19717621 missense possibly damaging 0.82
R7538:Nectin2 UTSW 7 19730619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTAGGGCAGCATCAGTG -3'
(R):5'- AGAGCTAGGGTGTGCATCTC -3'

Sequencing Primer
(F):5'- TAGGGCAGCATCAGTGACACC -3'
(R):5'- TGTGTACCCCTGGGACTGAG -3'
Posted On2019-10-17