Incidental Mutation 'R7523:Nat3'
ID582786
Institutional Source Beutler Lab
Gene Symbol Nat3
Ensembl Gene ENSMUSG00000056426
Gene NameN-acetyltransferase 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7523 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location67523854-67548627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67547574 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000069359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070514]
Predicted Effect probably damaging
Transcript: ENSMUST00000070514
AA Change: I35T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069359
Gene: ENSMUSG00000056426
AA Change: I35T

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Nat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Nat3 APN 8 67547746 nonsense probably null
IGL03277:Nat3 APN 8 67547689 missense probably benign 0.11
IGL02802:Nat3 UTSW 8 67547508 missense probably benign 0.08
R0266:Nat3 UTSW 8 67547780 missense probably benign
R0842:Nat3 UTSW 8 67547997 missense probably benign 0.01
R5245:Nat3 UTSW 8 67548180 missense probably benign 0.09
R5461:Nat3 UTSW 8 67547862 missense probably damaging 1.00
R5892:Nat3 UTSW 8 67547938 missense probably benign 0.01
R6371:Nat3 UTSW 8 67524179 splice site probably null
R7587:Nat3 UTSW 8 67547574 missense probably damaging 0.99
R7677:Nat3 UTSW 8 67547487 missense probably damaging 1.00
X0067:Nat3 UTSW 8 67548334 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTTATAAGGAACTCCAAGTGCAG -3'
(R):5'- TGATGGTCACCTGTAGTAGAAGG -3'

Sequencing Primer
(F):5'- CCAAGTGCAGATAGTAACATTTGAC -3'
(R):5'- TTACTATACTTGCAGGCTGAAGGGAC -3'
Posted On2019-10-17