Incidental Mutation 'R7523:Sf3b3'
ID582789
Institutional Source Beutler Lab
Gene Symbol Sf3b3
Ensembl Gene ENSMUSG00000033732
Gene Namesplicing factor 3b, subunit 3
Synonyms5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7523 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location110810239-110846787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110813720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1023 (I1023T)
Ref Sequence ENSEMBL: ENSMUSP00000045073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042012]
Predicted Effect probably benign
Transcript: ENSMUST00000042012
AA Change: I1023T

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: I1023T

DomainStartEndE-ValueType
Blast:SH3 17 70 5e-13 BLAST
Pfam:MMS1_N 76 592 3.2e-185 PFAM
low complexity region 716 728 N/A INTRINSIC
Pfam:CPSF_A 863 1184 4.3e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Sf3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Sf3b3 APN 8 110813751 nonsense probably null
IGL00770:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL00774:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL01132:Sf3b3 APN 8 110842781 missense probably benign
IGL01487:Sf3b3 APN 8 110817660 missense probably benign 0.01
IGL02015:Sf3b3 APN 8 110816290 missense possibly damaging 0.82
IGL02126:Sf3b3 APN 8 110823443 missense probably benign
IGL02612:Sf3b3 APN 8 110842976 missense probably benign
IGL02833:Sf3b3 APN 8 110811977 critical splice donor site probably null
IGL03033:Sf3b3 APN 8 110810964 missense possibly damaging 0.62
IGL03366:Sf3b3 APN 8 110839954 missense probably damaging 1.00
R0458:Sf3b3 UTSW 8 110812136 splice site probably benign
R0907:Sf3b3 UTSW 8 110811510 splice site probably benign
R1344:Sf3b3 UTSW 8 110838303 missense probably damaging 0.98
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1736:Sf3b3 UTSW 8 110813832 missense probably benign
R1833:Sf3b3 UTSW 8 110817566 missense probably benign
R2225:Sf3b3 UTSW 8 110814573 missense probably damaging 1.00
R3236:Sf3b3 UTSW 8 110812020 missense probably damaging 0.99
R3615:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3616:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3683:Sf3b3 UTSW 8 110813621 critical splice donor site probably null
R4197:Sf3b3 UTSW 8 110821565 missense probably damaging 0.98
R4429:Sf3b3 UTSW 8 110826118 missense probably benign 0.01
R4674:Sf3b3 UTSW 8 110844505 missense probably damaging 0.99
R4895:Sf3b3 UTSW 8 110816024 missense probably benign 0.00
R4931:Sf3b3 UTSW 8 110816329 missense probably benign 0.00
R4948:Sf3b3 UTSW 8 110813669 missense probably damaging 0.99
R4999:Sf3b3 UTSW 8 110841203 missense probably benign 0.34
R5150:Sf3b3 UTSW 8 110823376 missense possibly damaging 0.88
R5175:Sf3b3 UTSW 8 110833835 missense probably benign
R5559:Sf3b3 UTSW 8 110838215 missense probably benign 0.00
R5866:Sf3b3 UTSW 8 110814634 missense probably benign
R5934:Sf3b3 UTSW 8 110823470 missense probably damaging 0.99
R6270:Sf3b3 UTSW 8 110841820 missense probably damaging 1.00
R6803:Sf3b3 UTSW 8 110825578 missense probably benign 0.01
R7078:Sf3b3 UTSW 8 110813007 missense possibly damaging 0.90
R7252:Sf3b3 UTSW 8 110839930 missense probably damaging 0.99
R7467:Sf3b3 UTSW 8 110811456 missense possibly damaging 0.89
R7544:Sf3b3 UTSW 8 110838283 missense probably benign 0.01
R7638:Sf3b3 UTSW 8 110820813 missense probably damaging 1.00
X0024:Sf3b3 UTSW 8 110842932 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCAAGAGAGGTTAGATGCCTTG -3'
(R):5'- AGCTGGGCTTTTAGATTCTGAATTC -3'

Sequencing Primer
(F):5'- GAGGTTAGATGCCTTGAACATAAG -3'
(R):5'- GATTCTGAATTCAGGGATCACAC -3'
Posted On2019-10-17