Incidental Mutation 'R7523:Slc44a2'
ID582790
Institutional Source Beutler Lab
Gene Symbol Slc44a2
Ensembl Gene ENSMUSG00000057193
Gene Namesolute carrier family 44, member 2
Synonyms1110028E10Rik, CTL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21320698-21355028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21345992 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000034697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034697] [ENSMUST00000215574] [ENSMUST00000217461]
Predicted Effect probably null
Transcript: ENSMUST00000034697
AA Change: E411G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034697
Gene: ENSMUSG00000057193
AA Change: E411G

DomainStartEndE-ValueType
Blast:CLECT 4 37 8e-8 BLAST
transmembrane domain 231 253 N/A INTRINSIC
transmembrane domain 255 277 N/A INTRINSIC
Pfam:Choline_transpo 319 678 3.9e-119 PFAM
low complexity region 691 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213535
Predicted Effect probably benign
Transcript: ENSMUST00000214268
Predicted Effect possibly damaging
Transcript: ENSMUST00000215574
AA Change: E409G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000217461
AA Change: E409G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cochlear hair cell loss, spiral ganglion degeneration, and progressive sensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Slc44a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Slc44a2 APN 9 21345935 missense probably damaging 0.96
IGL01506:Slc44a2 APN 9 21337950 missense probably benign 0.30
IGL01687:Slc44a2 APN 9 21345947 missense probably benign 0.00
IGL01786:Slc44a2 APN 9 21352486 missense probably damaging 1.00
IGL01795:Slc44a2 APN 9 21345349 missense probably damaging 0.97
IGL02338:Slc44a2 APN 9 21347042 missense probably damaging 1.00
IGL02701:Slc44a2 APN 9 21347951 missense probably benign 0.01
IGL02820:Slc44a2 APN 9 21342977 missense probably benign
IGL03087:Slc44a2 APN 9 21346765 missense probably benign 0.00
IGL03153:Slc44a2 APN 9 21343200 missense probably benign 0.44
IGL03233:Slc44a2 APN 9 21348622 missense possibly damaging 0.95
Loaded UTSW 9 21348149 critical splice donor site probably null
R1177:Slc44a2 UTSW 9 21348583 missense probably benign 0.00
R1367:Slc44a2 UTSW 9 21343026 missense probably benign 0.00
R1474:Slc44a2 UTSW 9 21353694 missense probably damaging 0.99
R2077:Slc44a2 UTSW 9 21353724 missense probably damaging 1.00
R2432:Slc44a2 UTSW 9 21344834 missense probably damaging 1.00
R3722:Slc44a2 UTSW 9 21342977 missense possibly damaging 0.78
R3958:Slc44a2 UTSW 9 21348541 missense probably damaging 0.96
R4557:Slc44a2 UTSW 9 21346783 missense possibly damaging 0.93
R4641:Slc44a2 UTSW 9 21346882 missense probably damaging 1.00
R4725:Slc44a2 UTSW 9 21348395 missense probably damaging 1.00
R4859:Slc44a2 UTSW 9 21348145 missense probably damaging 0.98
R6701:Slc44a2 UTSW 9 21320853 critical splice donor site probably null
R7068:Slc44a2 UTSW 9 21320848 missense probably benign 0.00
R7206:Slc44a2 UTSW 9 21346807 missense probably damaging 1.00
R7233:Slc44a2 UTSW 9 21348149 critical splice donor site probably null
R7287:Slc44a2 UTSW 9 21342456 missense probably benign
R7329:Slc44a2 UTSW 9 21342752 missense probably damaging 1.00
R7432:Slc44a2 UTSW 9 21343215 missense probably benign 0.00
R7442:Slc44a2 UTSW 9 21345523 missense probably damaging 1.00
R7448:Slc44a2 UTSW 9 21348346 missense possibly damaging 0.87
R7514:Slc44a2 UTSW 9 21342472 missense possibly damaging 0.46
R8167:Slc44a2 UTSW 9 21346772 missense possibly damaging 0.67
R8211:Slc44a2 UTSW 9 21348138 missense probably damaging 1.00
R8240:Slc44a2 UTSW 9 21342185 missense probably benign
R8293:Slc44a2 UTSW 9 21353688 missense probably damaging 1.00
R8294:Slc44a2 UTSW 9 21348347 missense probably damaging 1.00
R8341:Slc44a2 UTSW 9 21342199 missense probably benign 0.00
R8471:Slc44a2 UTSW 9 21341969 missense probably null 0.08
X0018:Slc44a2 UTSW 9 21342788 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAGCTAGCCTCCTACCTC -3'
(R):5'- TTAGTGAGAGATGCTGTCTGAAAGG -3'

Sequencing Primer
(F):5'- CTGAAGTCTCAGGATTCCAAGG -3'
(R):5'- ATGCTGTCTGAAAGGAGTAAGGTTG -3'
Posted On2019-10-17