Incidental Mutation 'R7523:Prss35'
ID582791
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Nameprotease, serine 35
Synonyms6030424L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location86743649-86758443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86755374 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 66 (C66S)
Ref Sequence ENSEMBL: ENSMUSP00000035271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
Predicted Effect probably damaging
Transcript: ENSMUST00000036426
AA Change: C66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: C66S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179574
AA Change: C66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: C66S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86755274 missense probably benign 0.00
IGL02749:Prss35 APN 9 86756244 missense probably damaging 1.00
R0346:Prss35 UTSW 9 86755351 missense probably benign 0.04
R0403:Prss35 UTSW 9 86756037 missense probably damaging 1.00
R1664:Prss35 UTSW 9 86755647 missense probably benign 0.29
R2016:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2017:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2325:Prss35 UTSW 9 86756304 missense probably damaging 1.00
R2429:Prss35 UTSW 9 86755345 missense probably benign
R2965:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R2966:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R3961:Prss35 UTSW 9 86755749 missense probably benign 0.02
R4792:Prss35 UTSW 9 86755669 missense probably damaging 1.00
R4902:Prss35 UTSW 9 86756122 missense probably damaging 1.00
R6169:Prss35 UTSW 9 86755438 missense probably benign 0.00
R6446:Prss35 UTSW 9 86755653 missense probably damaging 0.99
R6753:Prss35 UTSW 9 86756100 missense probably damaging 1.00
R7008:Prss35 UTSW 9 86756308 missense probably benign 0.01
R7387:Prss35 UTSW 9 86755921 missense probably damaging 1.00
R7587:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7652:Prss35 UTSW 9 86755970 missense probably benign
R8013:Prss35 UTSW 9 86755425 missense probably damaging 1.00
R8194:Prss35 UTSW 9 86755613 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATGGAAAATACGTTACTCTGGTTGG -3'
(R):5'- AGATGCTGAACCTGCTGTC -3'

Sequencing Primer
(F):5'- ACTCTGGTTGGTAATTTTAATCCCTG -3'
(R):5'- ATGCTGAACCTGCTGTCCGTAC -3'
Posted On2019-10-17