Mutagenetix > Incidental Mutations

Incidental Mutation 'R7523:Cyth1'

582794

Institutional Source

Beutler Lab

Gene Symbol

Cyth1

Ensembl Gene

ENSMUSG00000017132

Gene Name

cytohesin 1

Synonyms

CTH-1, Pscd1, CLM1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R7523 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

118132019-118248592 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

TGGGCAA to T at 118183923 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]

Predicted Effect

probably null
Transcript: ENSMUST00000017276

SMART Domains

Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
Sec7	59	244	1.38e-108	SMART
PH	261	378	4.8e-25	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100181

SMART Domains

Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
Sec7	73	258	1.38e-108	SMART
PH	275	392	1.65e-23	SMART
low complexity region	402	425	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106302

SMART Domains

Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
Sec7	61	246	1.38e-108	SMART
PH	263	381	4.18e-25	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000106305

SMART Domains

Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
Sec7	59	244	1.38e-108	SMART
PH	261	379	4.18e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151165

SMART Domains

Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
SCOP:d1pbv__	55	99	4e-15	SMART
PDB:1BC9\|A	60	99	9e-21	PDB
Blast:Sec7	61	99	1e-20	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	A	2: 68,662,480	H40Q	unknown	Het
4932414N04Rik	A	T	2: 68,739,329	Q463L	probably benign	Het
Ano4	C	A	10: 88,971,395	E775*	probably null	Het
Atp12a	T	C	14: 56,365,968	V10A	possibly damaging	Het
Camkmt	A	G	17: 85,391,628	I144M	probably benign	Het
Dazl	G	A	17: 50,287,541	T162I	probably damaging	Het
Dnah10	A	G	5: 124,747,739	K653R	probably damaging	Het
Exosc10	A	T	4: 148,563,842		probably null	Het
Fam96b	G	A	8: 104,641,772		probably benign	Het
Fbn2	T	C	18: 58,066,080	D1372G	probably benign	Het
Fxr1	T	C	3: 34,039,543	V23A	probably benign	Het
Gmps	T	C	3: 64,011,666	I557T	possibly damaging	Het
Ifnab	A	T	4: 88,690,792	Y146N	probably damaging	Het
Krt78	T	C	15: 101,946,601	Y925C	not run	Het
Lrp1b	C	T	2: 41,511,461	V394M		Het
Ltbp2	T	C	12: 84,791,034	T1211A	probably benign	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mdn1	A	T	4: 32,667,270		probably null	Het
Myo15b	A	T	11: 115,890,858	I2798F	unknown	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nectin2	A	G	7: 19,730,112	V314A	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nfx1	A	G	4: 41,016,119	I894V	probably benign	Het
Olfr1045	T	C	2: 86,198,045	K236E	probably damaging	Het
Olfr15	T	C	16: 3,839,699	V242A	probably benign	Het
Pdcd4	G	T	19: 53,910,948	V123F	probably damaging	Het
Pik3c3	C	T	18: 30,293,655	R275W	probably damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Ptbp3	A	G	4: 59,546,159	V11A	probably benign	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Ptprg	T	G	14: 12,237,130	I1383S	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Sf3b3	A	G	8: 110,813,720	I1023T	probably benign	Het
Slc44a2	A	G	9: 21,345,992	E411G	probably null	Het
Stard9	T	C	2: 120,699,597	Y2112H	probably benign	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tenm2	A	T	11: 36,078,581		probably null	Het
Tle1	A	T	4: 72,145,418	S199R	possibly damaging	Het
Tubgcp2	A	G	7: 140,006,870	I399T	probably benign	Het
Ubr5	T	C	15: 38,004,055	N1344S		Het
Vmn2r114	A	G	17: 23,310,637	F164L	probably benign	Het
Vps13a	G	T	19: 16,703,789	T1041K	probably benign	Het
Zbtb20	T	C	16: 43,610,512	V389A	probably benign	Het
Zfp811	A	T	17: 32,797,752	I438N	probably benign	Het
Zfp90	A	G	8: 106,423,913	D86G	probably benign	Het

Other mutations in Cyth1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Cyth1	APN	11	118193613	critical splice donor site	probably null
IGL02047:Cyth1	APN	11	118169132	missense	probably damaging	1.00
IGL02658:Cyth1	APN	11	118182246	missense	probably damaging	0.99
IGL02826:Cyth1	APN	11	118185481	missense	possibly damaging	0.89
Mucilage	UTSW	11	118170860	missense	probably damaging	1.00
Stuck	UTSW	11	118185759	critical splice donor site	probably null
tarred	UTSW	11	118183923	nonsense	probably null
R0109:Cyth1	UTSW	11	118182306	missense	probably damaging	0.98
R0109:Cyth1	UTSW	11	118182306	missense	probably damaging	0.98
R0470:Cyth1	UTSW	11	118132248	unclassified	probably benign
R1387:Cyth1	UTSW	11	118182346	unclassified	probably benign
R1599:Cyth1	UTSW	11	118177221	missense	probably damaging	0.99
R2098:Cyth1	UTSW	11	118193653	missense	probably damaging	1.00
R2156:Cyth1	UTSW	11	118182808	missense	probably damaging	1.00
R3546:Cyth1	UTSW	11	118192436	missense	probably damaging	0.96
R4300:Cyth1	UTSW	11	118183894	missense	probably damaging	0.98
R4589:Cyth1	UTSW	11	118184985	missense	possibly damaging	0.70
R4799:Cyth1	UTSW	11	118183942	missense	probably damaging	1.00
R5165:Cyth1	UTSW	11	118169082	missense	possibly damaging	0.82
R5524:Cyth1	UTSW	11	118182767	missense	probably benign	0.27
R5834:Cyth1	UTSW	11	118192463	critical splice acceptor site	probably null
R5933:Cyth1	UTSW	11	118185759	critical splice donor site	probably null
R5960:Cyth1	UTSW	11	118132367	unclassified	probably benign
R6609:Cyth1	UTSW	11	118170860	missense	probably damaging	1.00
R7014:Cyth1	UTSW	11	118212651	missense	probably benign
R7108:Cyth1	UTSW	11	118182913	missense	probably damaging	0.99
R7237:Cyth1	UTSW	11	118185495	missense	probably damaging	1.00
R7401:Cyth1	UTSW	11	118182251	missense	possibly damaging	0.94
R7424:Cyth1	UTSW	11	118184009	splice site	probably null
R7574:Cyth1	UTSW	11	118182863	missense	probably damaging	1.00
R7647:Cyth1	UTSW	11	118177288	missense	probably benign	0.00
R7731:Cyth1	UTSW	11	118169053	missense	possibly damaging	0.55
R7848:Cyth1	UTSW	11	118183923	nonsense	probably null
R7849:Cyth1	UTSW	11	118183923	nonsense	probably null
X0063:Cyth1	UTSW	11	118132329	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATGAGGCAAGCACTCCTC -3'
(R):5'- GCCACAGTGGTTACATTTGCTTC -3'

Sequencing Primer
(F):5'- CTAAGCACACCAGGTGTAGTGC -3'
(R):5'- ACAGTGGTTACATTTGCTTCTGTTC -3'

Posted On

2019-10-17