Mutagenetix > Incidental Mutations

Incidental Mutation 'R7523:Ltbp2'

582795

Institutional Source

Beutler Lab

Gene Symbol

Ltbp2

Ensembl Gene

ENSMUSG00000002020

Gene Name

latent transforming growth factor beta binding protein 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.825) question?

Stock #

R7523 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84783212-84876532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84791034 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1211 (T1211A)

Ref Sequence

ENSEMBL: ENSMUSP00000105883 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]

Predicted Effect

probably benign
Transcript: ENSMUST00000002073
AA Change: T1234A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: T1234A

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	546	582	3.8e-9	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	666	707	3.4e-17	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	917	1.75e-10	SMART
EGF_CA	918	957	1.53e-10	SMART
EGF_CA	958	997	3.51e-10	SMART
EGF_CA	998	1038	8.3e-12	SMART
EGF_CA	1039	1080	4.56e-9	SMART
EGF_CA	1081	1122	4.56e-9	SMART
EGF_CA	1123	1163	8.76e-11	SMART
EGF_CA	1164	1205	4.38e-11	SMART
EGF_CA	1206	1246	1.75e-10	SMART
EGF_CA	1247	1290	2.24e-8	SMART
EGF_CA	1291	1332	6.01e-9	SMART
EGF	1336	1375	1.95e1	SMART
Pfam:TB	1410	1450	1.4e-13	PFAM
EGF_CA	1473	1515	2.31e-10	SMART
EGF_CA	1516	1555	7.93e-9	SMART
Pfam:TB	1582	1623	1e-13	PFAM
low complexity region	1691	1704	N/A	INTRINSIC
EGF	1724	1761	4e-5	SMART
EGF_CA	1762	1806	1.91e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110254
AA Change: T1211A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: T1211A

Domain	Start	End	E-Value	Type
low complexity region	119	128	N/A	INTRINSIC
EGF	204	233	6.55e-1	SMART
low complexity region	275	295	N/A	INTRINSIC
EGF	404	433	8.19e-2	SMART
low complexity region	535	546	N/A	INTRINSIC
Pfam:TB	565	602	4e-8	PFAM
EGF_CA	626	666	8.05e-10	SMART
Pfam:TB	685	727	3.7e-16	PFAM
EGF_CA	852	894	7.18e-7	SMART
EGF_CA	895	934	1.53e-10	SMART
EGF_CA	935	974	3.51e-10	SMART
EGF_CA	975	1015	8.3e-12	SMART
EGF_CA	1016	1057	4.56e-9	SMART
EGF_CA	1058	1099	4.56e-9	SMART
EGF_CA	1100	1140	8.76e-11	SMART
EGF_CA	1141	1182	4.38e-11	SMART
EGF_CA	1183	1223	1.75e-10	SMART
EGF_CA	1224	1267	2.24e-8	SMART
EGF_CA	1268	1309	6.01e-9	SMART
EGF	1313	1352	1.95e1	SMART
Pfam:TB	1387	1427	1.4e-11	PFAM
EGF_CA	1450	1492	2.31e-10	SMART
EGF_CA	1493	1532	7.93e-9	SMART
Pfam:TB	1558	1600	4.6e-13	PFAM
low complexity region	1668	1681	N/A	INTRINSIC
EGF	1701	1738	4e-5	SMART
EGF_CA	1739	1783	1.91e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163189
AA Change: T1191A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: T1191A

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	545	582	4e-8	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	665	707	3.8e-16	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	914	1.53e-10	SMART
EGF_CA	915	954	3.51e-10	SMART
EGF_CA	955	995	8.3e-12	SMART
EGF_CA	996	1037	4.56e-9	SMART
EGF_CA	1038	1079	4.56e-9	SMART
EGF_CA	1080	1120	8.76e-11	SMART
EGF_CA	1121	1162	4.38e-11	SMART
EGF_CA	1163	1203	1.75e-10	SMART
EGF_CA	1204	1247	2.24e-8	SMART
EGF_CA	1248	1289	6.01e-9	SMART
EGF	1293	1332	1.95e1	SMART
Pfam:TB	1367	1407	1.5e-11	PFAM
EGF_CA	1430	1472	2.31e-10	SMART
EGF_CA	1473	1512	7.93e-9	SMART
Pfam:TB	1538	1580	4.7e-13	PFAM
low complexity region	1648	1661	N/A	INTRINSIC
EGF	1681	1718	4e-5	SMART
EGF_CA	1719	1763	1.91e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163214

SMART Domains

Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	6	46	8.76e-11	SMART
EGF_CA	47	90	2.24e-8	SMART
EGF_CA	91	132	6.01e-9	SMART
EGF	136	175	1.95e1	SMART
Pfam:TB	210	250	1.5e-14	PFAM
EGF	276	307	1.5e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165141

SMART Domains

Protein: ENSMUSP00000132690
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF	1	31	1.2e1	SMART
EGF_CA	32	71	3.51e-10	SMART
EGF_CA	72	112	8.3e-12	SMART
EGF_CA	113	154	4.56e-9	SMART
EGF_like	155	183	1.67e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166383

SMART Domains

Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	8	49	2.13e-9	SMART
Pfam:TB	75	117	1.3e-14	PFAM
low complexity region	185	198	N/A	INTRINSIC

Meta Mutation Damage Score

0.0612

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	A	2: 68,662,480	H40Q	unknown	Het
4932414N04Rik	A	T	2: 68,739,329	Q463L	probably benign	Het
Ano4	C	A	10: 88,971,395	E775*	probably null	Het
Atp12a	T	C	14: 56,365,968	V10A	possibly damaging	Het
Camkmt	A	G	17: 85,391,628	I144M	probably benign	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dazl	G	A	17: 50,287,541	T162I	probably damaging	Het
Dnah10	A	G	5: 124,747,739	K653R	probably damaging	Het
Exosc10	A	T	4: 148,563,842		probably null	Het
Fam96b	G	A	8: 104,641,772		probably benign	Het
Fbn2	T	C	18: 58,066,080	D1372G	probably benign	Het
Fxr1	T	C	3: 34,039,543	V23A	probably benign	Het
Gmps	T	C	3: 64,011,666	I557T	possibly damaging	Het
Ifnab	A	T	4: 88,690,792	Y146N	probably damaging	Het
Krt78	T	C	15: 101,946,601	Y925C	not run	Het
Lrp1b	C	T	2: 41,511,461	V394M		Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mdn1	A	T	4: 32,667,270		probably null	Het
Myo15b	A	T	11: 115,890,858	I2798F	unknown	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nectin2	A	G	7: 19,730,112	V314A	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nfx1	A	G	4: 41,016,119	I894V	probably benign	Het
Olfr1045	T	C	2: 86,198,045	K236E	probably damaging	Het
Olfr15	T	C	16: 3,839,699	V242A	probably benign	Het
Pdcd4	G	T	19: 53,910,948	V123F	probably damaging	Het
Pik3c3	C	T	18: 30,293,655	R275W	probably damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Ptbp3	A	G	4: 59,546,159	V11A	probably benign	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Ptprg	T	G	14: 12,237,130	I1383S	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Sf3b3	A	G	8: 110,813,720	I1023T	probably benign	Het
Slc44a2	A	G	9: 21,345,992	E411G	probably null	Het
Stard9	T	C	2: 120,699,597	Y2112H	probably benign	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tenm2	A	T	11: 36,078,581		probably null	Het
Tle1	A	T	4: 72,145,418	S199R	possibly damaging	Het
Tubgcp2	A	G	7: 140,006,870	I399T	probably benign	Het
Ubr5	T	C	15: 38,004,055	N1344S		Het
Vmn2r114	A	G	17: 23,310,637	F164L	probably benign	Het
Vps13a	G	T	19: 16,703,789	T1041K	probably benign	Het
Zbtb20	T	C	16: 43,610,512	V389A	probably benign	Het
Zfp811	A	T	17: 32,797,752	I438N	probably benign	Het
Zfp90	A	G	8: 106,423,913	D86G	probably benign	Het

Other mutations in Ltbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Ltbp2	APN	12	84791064	missense	probably damaging	1.00
IGL00938:Ltbp2	APN	12	84831799	missense	probably benign	0.03
IGL01397:Ltbp2	APN	12	84790268	missense	probably damaging	1.00
IGL01570:Ltbp2	APN	12	84794033	missense	probably benign	0.05
IGL01631:Ltbp2	APN	12	84809146	critical splice donor site	probably null
IGL01662:Ltbp2	APN	12	84809246	missense	probably benign	0.00
IGL01728:Ltbp2	APN	12	84791009	missense	probably damaging	0.99
IGL01839:Ltbp2	APN	12	84793658	missense	possibly damaging	0.48
IGL01946:Ltbp2	APN	12	84830748	missense	probably damaging	1.00
IGL01977:Ltbp2	APN	12	84830199	missense	probably damaging	1.00
IGL02220:Ltbp2	APN	12	84829309	missense	possibly damaging	0.93
IGL02340:Ltbp2	APN	12	84792955	critical splice donor site	probably null
IGL02430:Ltbp2	APN	12	84799401	missense	probably damaging	1.00
IGL02492:Ltbp2	APN	12	84809665	missense	probably damaging	1.00
IGL02517:Ltbp2	APN	12	84785317	missense	probably benign	0.42
IGL02794:Ltbp2	APN	12	84791935	missense	probably damaging	1.00
deft	UTSW	12	84853912	missense	probably damaging	0.98
R0045:Ltbp2	UTSW	12	84809587	missense	probably damaging	1.00
R0045:Ltbp2	UTSW	12	84813288	missense	probably damaging	1.00
R0091:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R0094:Ltbp2	UTSW	12	84799426	missense	probably damaging	1.00
R0166:Ltbp2	UTSW	12	84786358	missense	probably benign	0.28
R0265:Ltbp2	UTSW	12	84785969	splice site	probably null
R0394:Ltbp2	UTSW	12	84806424	splice site	probably benign
R0535:Ltbp2	UTSW	12	84784858	missense	probably damaging	1.00
R0535:Ltbp2	UTSW	12	84791052	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1513:Ltbp2	UTSW	12	84791944	missense	probably damaging	1.00
R1858:Ltbp2	UTSW	12	84830781	nonsense	probably null
R1880:Ltbp2	UTSW	12	84829271	missense	probably benign	0.45
R1894:Ltbp2	UTSW	12	84787961	missense	probably damaging	1.00
R1900:Ltbp2	UTSW	12	84830658	missense	probably damaging	1.00
R1903:Ltbp2	UTSW	12	84830105	missense	probably benign	0.01
R1912:Ltbp2	UTSW	12	84785863	missense	probably damaging	0.98
R1993:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R1995:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R2069:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R2126:Ltbp2	UTSW	12	84785709	splice site	probably null
R2139:Ltbp2	UTSW	12	84815979	missense	probably damaging	1.00
R2341:Ltbp2	UTSW	12	84809163	missense	probably benign	0.08
R2511:Ltbp2	UTSW	12	84804409	splice site	probably null
R3737:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3738:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3739:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3889:Ltbp2	UTSW	12	84784907	unclassified	probably benign
R4034:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R4542:Ltbp2	UTSW	12	84831819	nonsense	probably null
R4621:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4623:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4831:Ltbp2	UTSW	12	84793640	missense	possibly damaging	0.55
R5080:Ltbp2	UTSW	12	84803864	missense	probably damaging	1.00
R5116:Ltbp2	UTSW	12	84809737	missense	probably damaging	1.00
R5351:Ltbp2	UTSW	12	84790358	missense	possibly damaging	0.95
R5445:Ltbp2	UTSW	12	84809654	missense	probably null	1.00
R5608:Ltbp2	UTSW	12	84787464	splice site	probably null
R5784:Ltbp2	UTSW	12	84868739	missense	probably damaging	1.00
R5838:Ltbp2	UTSW	12	84789101	missense	probably benign	0.16
R5859:Ltbp2	UTSW	12	84794063	missense	possibly damaging	0.52
R6004:Ltbp2	UTSW	12	84876149	missense	probably benign	0.00
R6028:Ltbp2	UTSW	12	84784852	missense	probably damaging	1.00
R6347:Ltbp2	UTSW	12	84853912	missense	probably damaging	0.98
R6615:Ltbp2	UTSW	12	84813317	missense	probably damaging	1.00
R6636:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6637:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6755:Ltbp2	UTSW	12	84795073	missense	probably damaging	1.00
R6759:Ltbp2	UTSW	12	84787410	missense	probably damaging	0.99
R6806:Ltbp2	UTSW	12	84809238	missense	possibly damaging	0.74
R6968:Ltbp2	UTSW	12	84789083	critical splice donor site	probably null
R7084:Ltbp2	UTSW	12	84868685	missense	probably damaging	1.00
R7250:Ltbp2	UTSW	12	84787392	nonsense	probably null
R7374:Ltbp2	UTSW	12	84830175	missense	probably damaging	1.00
R7501:Ltbp2	UTSW	12	84830645	missense	probably damaging	1.00
R7754:Ltbp2	UTSW	12	84813238	critical splice donor site	probably null
R7827:Ltbp2	UTSW	12	84789881	missense	probably benign	0.19
R8042:Ltbp2	UTSW	12	84791899	missense	probably damaging	0.99
R8110:Ltbp2	UTSW	12	84803902	nonsense	probably null
R8411:Ltbp2	UTSW	12	84786413	missense	probably damaging	1.00
X0017:Ltbp2	UTSW	12	84828528	missense	probably damaging	1.00
X0026:Ltbp2	UTSW	12	84830199	missense	probably damaging	1.00
Z1176:Ltbp2	UTSW	12	84875853	missense	probably benign	0.01
Z1177:Ltbp2	UTSW	12	84829316	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTATCATGCCAGCCTTGGG -3'
(R):5'- GCTCTAAAGAGACCCGTTAGC -3'

Sequencing Primer
(F):5'- ATCATGCCAGCCTTGGGTAAGTC -3'
(R):5'- TAAAGAGACCCGTTAGCTGCATCTG -3'

Posted On

2019-10-17