Incidental Mutation 'R7523:Olfr15'
ID582800
Institutional Source Beutler Lab
Gene Symbol Olfr15
Ensembl Gene ENSMUSG00000059043
Gene Nameolfactory receptor 15
SynonymsOR3, GA_x54KRFPKG5P-348087-349025, MOR256-17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location3830878-3844747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3839699 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 242 (V242A)
Ref Sequence ENSEMBL: ENSMUSP00000149504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080917] [ENSMUST00000214238] [ENSMUST00000214590]
Predicted Effect probably benign
Transcript: ENSMUST00000080917
AA Change: V242A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079720
Gene: ENSMUSG00000059043
AA Change: V242A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 301 2.7e-8 PFAM
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7tm_1 41 290 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214238
AA Change: V242A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214590
AA Change: V242A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Olfr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr15 APN 16 3839777 missense probably damaging 0.99
IGL02444:Olfr15 APN 16 3839687 missense probably damaging 1.00
IGL02516:Olfr15 APN 16 3839336 missense probably damaging 1.00
IGL02941:Olfr15 APN 16 3839816 missense possibly damaging 0.64
PIT4812001:Olfr15 UTSW 16 3839530 nonsense probably null
R0380:Olfr15 UTSW 16 3838985 missense probably benign
R1542:Olfr15 UTSW 16 3839832 missense probably damaging 1.00
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1633:Olfr15 UTSW 16 3839532 missense probably damaging 1.00
R4207:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R4632:Olfr15 UTSW 16 3839087 missense probably damaging 1.00
R4965:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R5014:Olfr15 UTSW 16 3839048 missense probably benign 0.01
R6575:Olfr15 UTSW 16 3839030 missense probably benign 0.00
R7367:Olfr15 UTSW 16 3839302 missense probably damaging 0.99
R7697:Olfr15 UTSW 16 3839566 missense probably damaging 0.96
R7876:Olfr15 UTSW 16 3838794 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCATGATTAAATTGGCCTGTGG -3'
(R):5'- GACGATTGTGCTGTCCTCAG -3'

Sequencing Primer
(F):5'- TTCACTGTGGTCCCAGTA -3'
(R):5'- AGCAATCTTCCCAGGGCC -3'
Posted On2019-10-17