Incidental Mutation 'R7523:Zbtb20'
ID582801
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Namezinc finger and BTB domain containing 20
SynonymsZfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location42875881-43642602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43610512 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 389 (V389A)
Ref Sequence ENSEMBL: ENSMUSP00000110339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
Predicted Effect probably benign
Transcript: ENSMUST00000079441
AA Change: V462A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: V462A

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114690
AA Change: V389A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: V389A

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114691
AA Change: V389A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: V389A

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114694
AA Change: V462A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: V462A

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114695
AA Change: V462A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: V462A

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146708
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148775
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156367
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156981
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43610661 missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43609662 missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43610648 nonsense probably null
IGL02733:Zbtb20 APN 16 43609933 missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43618437 missense possibly damaging 0.95
siberian UTSW 16 43610676 missense probably damaging 0.96
Tiger UTSW 16 43618398 missense probably damaging 0.98
Towering UTSW 16 43610867 nonsense probably null
R0310:Zbtb20 UTSW 16 43609746 missense probably damaging 0.98
R1593:Zbtb20 UTSW 16 43609423 missense probably damaging 0.99
R1996:Zbtb20 UTSW 16 43610080 missense probably damaging 0.98
R2018:Zbtb20 UTSW 16 43577652 missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43609612 splice site probably null
R2097:Zbtb20 UTSW 16 43609519 missense probably null 1.00
R4006:Zbtb20 UTSW 16 43609399 missense probably damaging 1.00
R4708:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43618398 missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43618692 missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43610867 nonsense probably null
R7452:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R8175:Zbtb20 UTSW 16 43577080 intron probably benign
R8306:Zbtb20 UTSW 16 43618737 missense probably damaging 0.99
Z1176:Zbtb20 UTSW 16 43610530 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CAGTGGAGCAACAGTTTGGG -3'
(R):5'- TGTCACAAACTGGGTCTGCTG -3'

Sequencing Primer
(F):5'- CAACAGTTTGGGGCAGCAGC -3'
(R):5'- AAACTGGGTCTGCTGGCCTG -3'
Posted On2019-10-17