Mutagenetix > Incidental Mutations

Incidental Mutation 'R7523:Vmn2r114'

582802

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r114

Ensembl Gene

ENSMUSG00000091945

Gene Name

vomeronasal 2, receptor 114

Synonyms

EG666002

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7523 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23290934-23312313 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23310637 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 164 (F164L)

Ref Sequence

ENSEMBL: ENSMUSP00000127505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168033]

Predicted Effect

probably benign
Transcript: ENSMUST00000168033
AA Change: F164L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: F164L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	470	1.5e-24	PFAM
Pfam:NCD3G	511	564	1.5e-18	PFAM
Pfam:7tm_3	597	832	1.4e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	A	2: 68,662,480	H40Q	unknown	Het
4932414N04Rik	A	T	2: 68,739,329	Q463L	probably benign	Het
Ano4	C	A	10: 88,971,395	E775*	probably null	Het
Atp12a	T	C	14: 56,365,968	V10A	possibly damaging	Het
Camkmt	A	G	17: 85,391,628	I144M	probably benign	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dazl	G	A	17: 50,287,541	T162I	probably damaging	Het
Dnah10	A	G	5: 124,747,739	K653R	probably damaging	Het
Exosc10	A	T	4: 148,563,842		probably null	Het
Fam96b	G	A	8: 104,641,772		probably benign	Het
Fbn2	T	C	18: 58,066,080	D1372G	probably benign	Het
Fxr1	T	C	3: 34,039,543	V23A	probably benign	Het
Gmps	T	C	3: 64,011,666	I557T	possibly damaging	Het
Ifnab	A	T	4: 88,690,792	Y146N	probably damaging	Het
Krt78	T	C	15: 101,946,601	Y925C	not run	Het
Lrp1b	C	T	2: 41,511,461	V394M		Het
Ltbp2	T	C	12: 84,791,034	T1211A	probably benign	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mdn1	A	T	4: 32,667,270		probably null	Het
Myo15b	A	T	11: 115,890,858	I2798F	unknown	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nectin2	A	G	7: 19,730,112	V314A	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nfx1	A	G	4: 41,016,119	I894V	probably benign	Het
Olfr1045	T	C	2: 86,198,045	K236E	probably damaging	Het
Olfr15	T	C	16: 3,839,699	V242A	probably benign	Het
Pdcd4	G	T	19: 53,910,948	V123F	probably damaging	Het
Pik3c3	C	T	18: 30,293,655	R275W	probably damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Ptbp3	A	G	4: 59,546,159	V11A	probably benign	Het
Ptpn22	A	G	3: 103,912,015	N795S	probably damaging	Het
Ptprg	T	G	14: 12,237,130	I1383S	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Sf3b3	A	G	8: 110,813,720	I1023T	probably benign	Het
Slc44a2	A	G	9: 21,345,992	E411G	probably null	Het
Stard9	T	C	2: 120,699,597	Y2112H	probably benign	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tenm2	A	T	11: 36,078,581		probably null	Het
Tle1	A	T	4: 72,145,418	S199R	possibly damaging	Het
Tubgcp2	A	G	7: 140,006,870	I399T	probably benign	Het
Ubr5	T	C	15: 38,004,055	N1344S		Het
Vps13a	G	T	19: 16,703,789	T1041K	probably benign	Het
Zbtb20	T	C	16: 43,610,512	V389A	probably benign	Het
Zfp811	A	T	17: 32,797,752	I438N	probably benign	Het
Zfp90	A	G	8: 106,423,913	D86G	probably benign	Het

Other mutations in Vmn2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Vmn2r114	APN	17	23291665	missense	probably damaging	1.00
IGL00990:Vmn2r114	APN	17	23290965	missense	probably benign
IGL00990:Vmn2r114	APN	17	23290983	missense	probably benign	0.23
IGL00990:Vmn2r114	APN	17	23291238	missense	probably damaging	1.00
IGL01838:Vmn2r114	APN	17	23296982	missense	probably benign	0.44
IGL01990:Vmn2r114	APN	17	23310381	missense	probably benign	0.22
IGL01994:Vmn2r114	APN	17	23310477	missense	probably damaging	1.00
IGL02153:Vmn2r114	APN	17	23291808	missense	probably benign	0.01
IGL02453:Vmn2r114	APN	17	23311134	missense	probably benign	0.00
IGL02621:Vmn2r114	APN	17	23310520	missense	probably damaging	0.98
IGL02938:Vmn2r114	APN	17	23291289	missense	probably benign	0.10
IGL03130:Vmn2r114	APN	17	23296996	splice site	probably benign
IGL03325:Vmn2r114	APN	17	23291678	missense	probably damaging	1.00
BB004:Vmn2r114	UTSW	17	23291645	missense	probably damaging	1.00
R0109:Vmn2r114	UTSW	17	23310575	nonsense	probably null
R0164:Vmn2r114	UTSW	17	23309826	critical splice donor site	probably null
R0310:Vmn2r114	UTSW	17	23290943	missense	probably benign	0.23
R0583:Vmn2r114	UTSW	17	23290932	makesense	probably null
R0677:Vmn2r114	UTSW	17	23310594	missense	probably damaging	1.00
R1127:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1157:Vmn2r114	UTSW	17	23310340	missense	possibly damaging	0.60
R1323:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1347:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1435:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1437:Vmn2r114	UTSW	17	23291211	missense	probably damaging	1.00
R1585:Vmn2r114	UTSW	17	23291701	missense	probably damaging	0.98
R1641:Vmn2r114	UTSW	17	23296988	missense	probably benign	0.00
R1748:Vmn2r114	UTSW	17	23308061	missense	probably benign	0.17
R1954:Vmn2r114	UTSW	17	23311112	missense	probably benign	0.32
R2081:Vmn2r114	UTSW	17	23291109	missense	possibly damaging	0.91
R2103:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2113:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2134:Vmn2r114	UTSW	17	23291763	missense	probably damaging	1.00
R2149:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2424:Vmn2r114	UTSW	17	23296868	missense	possibly damaging	0.90
R2847:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2848:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2893:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3017:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3018:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3019:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3020:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3021:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4628:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4668:Vmn2r114	UTSW	17	23310473	missense	possibly damaging	0.83
R4840:Vmn2r114	UTSW	17	23291379	missense	probably damaging	0.97
R4841:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4842:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4856:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4886:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4992:Vmn2r114	UTSW	17	23291791	missense	probably benign	0.03
R5182:Vmn2r114	UTSW	17	23291658	missense	probably damaging	0.96
R5223:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5405:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5449:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5615:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5834:Vmn2r114	UTSW	17	23310625	missense	possibly damaging	0.90
R6150:Vmn2r114	UTSW	17	23291295	missense	probably benign	0.03
R6277:Vmn2r114	UTSW	17	23290980	missense	possibly damaging	0.93
R6403:Vmn2r114	UTSW	17	23309965	missense	probably damaging	0.99
R6589:Vmn2r114	UTSW	17	23291668	missense	probably damaging	1.00
R6613:Vmn2r114	UTSW	17	23310246	missense	possibly damaging	0.82
R6747:Vmn2r114	UTSW	17	23309876	missense	probably benign	0.00
R6837:Vmn2r114	UTSW	17	23310202	missense	probably benign	0.10
R6911:Vmn2r114	UTSW	17	23291130	missense	probably damaging	0.98
R6950:Vmn2r114	UTSW	17	23310163	missense	probably benign	0.03
R7276:Vmn2r114	UTSW	17	23290960	missense	probably damaging	0.97
R7482:Vmn2r114	UTSW	17	23291494	missense	probably damaging	1.00
R7514:Vmn2r114	UTSW	17	23308061	missense	probably null	0.96
R7563:Vmn2r114	UTSW	17	23291026	missense	probably benign	0.01
R7585:Vmn2r114	UTSW	17	23291265	missense	probably damaging	1.00
R7593:Vmn2r114	UTSW	17	23291843	nonsense	probably null
R7611:Vmn2r114	UTSW	17	23296970	missense	probably damaging	0.97
R7641:Vmn2r114	UTSW	17	23308203	missense	possibly damaging	0.53
R7651:Vmn2r114	UTSW	17	23291012	nonsense	probably null
R7970:Vmn2r114	UTSW	17	23311212	missense	probably benign	0.00
X0065:Vmn2r114	UTSW	17	23310957	missense	probably benign	0.34
Z1088:Vmn2r114	UTSW	17	23290932	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCATTGTCTGAGATGGCCAG -3'
(R):5'- AAGCAGAGTGGGAATTCTGTC -3'

Sequencing Primer
(F):5'- TCTGAGATGGCCAGCCCTAC -3'
(R):5'- CTTACTTGGCCTGGGCAAATCTAAG -3'

Posted On

2019-10-17