Incidental Mutation 'R7523:Zfp811'
ID582803
Institutional Source Beutler Lab
Gene Symbol Zfp811
Ensembl Gene ENSMUSG00000055202
Gene Namezinc finger protein 811
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7523 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32795676-32809853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32797752 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 438 (I438N)
Ref Sequence ENSEMBL: ENSMUSP00000144038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080905] [ENSMUST00000200914]
Predicted Effect probably benign
Transcript: ENSMUST00000080905
AA Change: I437N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079709
Gene: ENSMUSG00000055202
AA Change: I437N

DomainStartEndE-ValueType
KRAB 3 62 6.26e-16 SMART
ZnF_C2H2 192 215 1.25e-1 SMART
ZnF_C2H2 220 242 1.79e-2 SMART
ZnF_C2H2 248 270 9.08e-4 SMART
ZnF_C2H2 276 298 7.78e-3 SMART
ZnF_C2H2 304 326 3.69e-4 SMART
ZnF_C2H2 332 354 8.47e-4 SMART
ZnF_C2H2 360 382 1.45e-2 SMART
ZnF_C2H2 388 410 6.42e-4 SMART
ZnF_C2H2 416 438 5.9e-3 SMART
ZnF_C2H2 444 466 1.08e-1 SMART
ZnF_C2H2 472 494 2.75e-3 SMART
ZnF_C2H2 500 522 9.44e-2 SMART
ZnF_C2H2 528 551 3.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200914
AA Change: I438N

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144038
Gene: ENSMUSG00000055202
AA Change: I438N

DomainStartEndE-ValueType
KRAB 4 63 2.6e-18 SMART
ZnF_C2H2 193 216 5.4e-4 SMART
ZnF_C2H2 221 243 7.8e-5 SMART
ZnF_C2H2 249 271 3.8e-6 SMART
ZnF_C2H2 277 299 3.3e-5 SMART
ZnF_C2H2 305 327 1.6e-6 SMART
ZnF_C2H2 333 355 3.8e-6 SMART
ZnF_C2H2 361 383 6.1e-5 SMART
ZnF_C2H2 389 411 2.7e-6 SMART
ZnF_C2H2 417 439 2.5e-5 SMART
ZnF_C2H2 445 467 4.6e-4 SMART
ZnF_C2H2 473 495 1.2e-5 SMART
ZnF_C2H2 501 523 4e-4 SMART
ZnF_C2H2 529 552 1.7e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Zfp811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp811 APN 17 32797820 missense probably damaging 1.00
IGL02227:Zfp811 APN 17 32798642 nonsense probably null
IGL02529:Zfp811 APN 17 32797815 missense probably damaging 1.00
IGL03190:Zfp811 APN 17 32798881 splice site probably benign
R0112:Zfp811 UTSW 17 32797764 missense probably damaging 0.96
R1025:Zfp811 UTSW 17 32798644 missense probably benign 0.00
R1522:Zfp811 UTSW 17 32797648 missense probably damaging 1.00
R1829:Zfp811 UTSW 17 32798142 missense possibly damaging 0.72
R1861:Zfp811 UTSW 17 32797425 missense probably damaging 1.00
R2181:Zfp811 UTSW 17 32797721 missense probably damaging 0.96
R4360:Zfp811 UTSW 17 32798458 missense probably benign 0.01
R4425:Zfp811 UTSW 17 32797547 nonsense probably null
R4657:Zfp811 UTSW 17 32800923 nonsense probably null
R6066:Zfp811 UTSW 17 32798827 missense possibly damaging 0.73
R6109:Zfp811 UTSW 17 32797374 unclassified probably null
R6702:Zfp811 UTSW 17 32797842 missense probably damaging 1.00
R6714:Zfp811 UTSW 17 32797762 missense probably damaging 1.00
R6826:Zfp811 UTSW 17 32797788 missense probably damaging 1.00
R6983:Zfp811 UTSW 17 32797432 nonsense probably null
R7276:Zfp811 UTSW 17 32798781 missense probably benign 0.00
R7343:Zfp811 UTSW 17 32797513 missense probably damaging 0.98
R7432:Zfp811 UTSW 17 32798759 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATTCATGGGGTTTCTCTCCG -3'
(R):5'- AAGCATAAAATAGTTCACAGCGGTG -3'

Sequencing Primer
(F):5'- GACACAAGGCTTCTCTCCAGTG -3'
(R):5'- ACAGCGGTGTGAATCCCTTTG -3'
Posted On2019-10-17