Incidental Mutation 'R7523:Dazl'
ID582805
Institutional Source Beutler Lab
Gene Symbol Dazl
Ensembl Gene ENSMUSG00000010592
Gene Namedeleted in azoospermia-like
SynonymsDaz-like, Tpx2, Dazla, Tpx-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location50279394-50293599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50287541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 162 (T162I)
Ref Sequence ENSEMBL: ENSMUSP00000010736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010736]
PDB Structure
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH RNA, UUGUUCUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH MVH RNA, UGUUC [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH SYCP3 RNA, UUGUUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000010736
AA Change: T162I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000010736
Gene: ENSMUSG00000010592
AA Change: T162I

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
RRM 41 111 2.16e-19 SMART
low complexity region 125 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit sterility with a complete absence of mature germ cells. In mutants, few spermatogonia enter meiosis, and those that do fail to proceed beyond pachytene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pdcd4 G T 19: 53,910,948 V123F probably damaging Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Dazl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Dazl APN 17 50293398 splice site probably benign
R0063:Dazl UTSW 17 152705859 missense probably damaging 1.00
R3801:Dazl UTSW 17 50281281 missense probably benign 0.44
R3961:Dazl UTSW 17 50288133 missense probably damaging 0.99
R4646:Dazl UTSW 17 50288155 missense probably damaging 1.00
R5310:Dazl UTSW 17 50281283 missense probably damaging 1.00
R5389:Dazl UTSW 17 50288690 missense probably benign 0.25
R5933:Dazl UTSW 17 50287753 critical splice donor site probably null
R6173:Dazl UTSW 17 50287571 missense probably benign 0.05
R7057:Dazl UTSW 17 50293406 start codon destroyed probably null
R8393:Dazl UTSW 17 50281266 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTACCAAGGTTCTAGGATAATGGC -3'
(R):5'- GCCTAGGTTTTCAGAGAACGC -3'

Sequencing Primer
(F):5'- GATTTCAGCTTAGCATAAACAGCGC -3'
(R):5'- GGTTTTCAGAGAACGCAATGTAAC -3'
Posted On2019-10-17