Incidental Mutation 'R7523:Pdcd4'
ID582810
Institutional Source Beutler Lab
Gene Symbol Pdcd4
Ensembl Gene ENSMUSG00000024975
Gene Nameprogrammed cell death 4
SynonymsMA-3, D19Ucla1, TIS
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R7523 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location53892231-53929861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53910948 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 123 (V123F)
Ref Sequence ENSEMBL: ENSMUSP00000025931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025931] [ENSMUST00000074371] [ENSMUST00000165617]
Predicted Effect probably damaging
Transcript: ENSMUST00000025931
AA Change: V123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025931
Gene: ENSMUSG00000024975
AA Change: V123F

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074371
AA Change: V123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073975
Gene: ENSMUSG00000024975
AA Change: V123F

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165617
AA Change: V123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133135
Gene: ENSMUSG00000024975
AA Change: V123F

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a tumor suppressor and encodes a protein that binds to the eukaryotic translation initiation factor 4A1 and inhibits its function by preventing RNA binding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null allele have a higher prevalence of B cell derived lymphomas, multi-organ cysts and decreased susceptibility to experimentally induced autoimmune encephalomyelitis and type 1 diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,480 H40Q unknown Het
4932414N04Rik A T 2: 68,739,329 Q463L probably benign Het
Ano4 C A 10: 88,971,395 E775* probably null Het
Atp12a T C 14: 56,365,968 V10A possibly damaging Het
Camkmt A G 17: 85,391,628 I144M probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dazl G A 17: 50,287,541 T162I probably damaging Het
Dnah10 A G 5: 124,747,739 K653R probably damaging Het
Exosc10 A T 4: 148,563,842 probably null Het
Fam96b G A 8: 104,641,772 probably benign Het
Fbn2 T C 18: 58,066,080 D1372G probably benign Het
Fxr1 T C 3: 34,039,543 V23A probably benign Het
Gmps T C 3: 64,011,666 I557T possibly damaging Het
Ifnab A T 4: 88,690,792 Y146N probably damaging Het
Krt78 T C 15: 101,946,601 Y925C not run Het
Lrp1b C T 2: 41,511,461 V394M Het
Ltbp2 T C 12: 84,791,034 T1211A probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mdn1 A T 4: 32,667,270 probably null Het
Myo15b A T 11: 115,890,858 I2798F unknown Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nectin2 A G 7: 19,730,112 V314A probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nfx1 A G 4: 41,016,119 I894V probably benign Het
Olfr1045 T C 2: 86,198,045 K236E probably damaging Het
Olfr15 T C 16: 3,839,699 V242A probably benign Het
Pik3c3 C T 18: 30,293,655 R275W probably damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Ptbp3 A G 4: 59,546,159 V11A probably benign Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Ptprg T G 14: 12,237,130 I1383S probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Sf3b3 A G 8: 110,813,720 I1023T probably benign Het
Slc44a2 A G 9: 21,345,992 E411G probably null Het
Stard9 T C 2: 120,699,597 Y2112H probably benign Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tenm2 A T 11: 36,078,581 probably null Het
Tle1 A T 4: 72,145,418 S199R possibly damaging Het
Tubgcp2 A G 7: 140,006,870 I399T probably benign Het
Ubr5 T C 15: 38,004,055 N1344S Het
Vmn2r114 A G 17: 23,310,637 F164L probably benign Het
Vps13a G T 19: 16,703,789 T1041K probably benign Het
Zbtb20 T C 16: 43,610,512 V389A probably benign Het
Zfp811 A T 17: 32,797,752 I438N probably benign Het
Zfp90 A G 8: 106,423,913 D86G probably benign Het
Other mutations in Pdcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Pdcd4 APN 19 53929121 missense probably benign
IGL02608:Pdcd4 APN 19 53927207 splice site probably null
seventh UTSW 19 53922133 critical splice donor site probably null
Uccidere UTSW 19 53910948 missense probably damaging 1.00
R0893:Pdcd4 UTSW 19 53929094 missense probably damaging 1.00
R1437:Pdcd4 UTSW 19 53909243 missense probably damaging 0.99
R1836:Pdcd4 UTSW 19 53926219 missense probably damaging 1.00
R4298:Pdcd4 UTSW 19 53919661 missense probably damaging 1.00
R6365:Pdcd4 UTSW 19 53922133 critical splice donor site probably null
R6436:Pdcd4 UTSW 19 53926931 splice site probably null
R8244:Pdcd4 UTSW 19 53907534 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATAGGGTCATGTTCTGAAAGG -3'
(R):5'- TCTTGACTCCCAAAACAAGTGG -3'

Sequencing Primer
(F):5'- CTGAAAGGTCTGTGGTATGGC -3'
(R):5'- TCCCAATCTGTATATATGATTTTGCC -3'
Posted On2019-10-17