Mutagenetix > Incidental Mutation

Incidental Mutation 'R7524:Kcnt2'

582812

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R7524 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 140584055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 983 (T983S)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably damaging
Transcript: ENSMUST00000119786
AA Change: T916S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: T916S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120709
AA Change: T959S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: T959S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: T983S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: T983S

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	C	T	8: 55,872,360	C353Y	probably damaging	Het
Afap1l2	T	A	19: 56,918,111	E452V	probably damaging	Het
AI464131	C	A	4: 41,498,779	V284L	probably benign	Het
Ak6	A	G	13: 100,663,907	D45G	probably benign	Het
Arhgap17	G	A	7: 123,306,420	P334L	probably damaging	Het
Asns	G	T	6: 7,677,259		probably null	Het
Bend7	A	G	2: 4,799,980	T424A	probably benign	Het
Btbd2	C	T	10: 80,646,444	E241K	probably damaging	Het
Commd2	A	C	3: 57,650,148	L99W	probably damaging	Het
Cpne9	A	T	6: 113,302,064	D473V	probably damaging	Het
Cuzd1	A	T	7: 131,311,618	F423L	probably damaging	Het
Cyp2d9	T	C	15: 82,455,945	F390L	probably damaging	Het
Dcaf5	T	A	12: 80,376,696	Q234L	probably benign	Het
Dennd3	T	G	15: 73,524,246	Y201*	probably null	Het
Dnah17	T	C	11: 118,121,481	D485G	probably benign	Het
Dnah5	A	T	15: 28,297,066	T1469S	possibly damaging	Het
Dnah6	T	C	6: 73,118,099	D2167G	probably damaging	Het
Dst	T	C	1: 34,291,893	V4921A	possibly damaging	Het
Ephb2	A	G	4: 136,659,709	Y736H	probably damaging	Het
Eri2	C	G	7: 119,785,749	V510L	probably benign	Het
Eya2	G	A	2: 165,769,326		probably null	Het
Fam208a	T	A	14: 27,466,203	C869S	probably damaging	Het
Fastkd5	G	T	2: 130,616,128	Q181K	probably benign	Het
Fcgbp	T	C	7: 28,102,966	S1440P	probably damaging	Het
Fkbp9	G	A	6: 56,868,740	V354M	probably damaging	Het
Frmpd1	T	A	4: 45,271,181	S304T	probably benign	Het
Gtf2a2	T	A	9: 70,015,347	Y3*	probably null	Het
Hagh	G	A	17: 24,861,340	V226I	probably benign	Het
Hemk1	T	A	9: 107,328,285	I293F	probably benign	Het
Kcna3	A	G	3: 107,037,207	E262G	probably damaging	Het
Klhdc3	A	T	17: 46,678,414	H7Q	probably damaging	Het
Knl1	A	T	2: 119,065,979	Q94L	probably damaging	Het
Krt12	T	C	11: 99,419,659	D224G	probably damaging	Het
Lats1	T	A	10: 7,701,978	S289T	possibly damaging	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Map1a	G	A	2: 121,289,812	V60M	probably damaging	Het
Mms22l	T	A	4: 24,536,138	F536I	possibly damaging	Het
Ms4a14	T	C	19: 11,303,836	T453A	unknown	Het
Muc3a	A	C	5: 137,210,563	I151S	probably benign	Het
Oaf	G	A	9: 43,222,780	R215C	probably damaging	Het
Olfr1019	T	A	2: 85,841,357	M145L	probably benign	Het
Olfr1217	T	A	2: 89,023,971	I11L	probably benign	Het
Olfr1233	A	G	2: 89,339,877	C142R	probably benign	Het
Olfr1507	T	C	14: 52,490,293	I224V	probably damaging	Het
Olfr5	T	C	7: 6,480,587	N190D	probably benign	Het
Olfr8	T	A	10: 78,955,491	Y95*	probably null	Het
Pcdhgb4	A	T	18: 37,721,608	D352V	probably benign	Het
Pced1a	A	G	2: 130,422,028	F235L	probably benign	Het
Pclo	A	G	5: 14,678,303	I2392V	unknown	Het
Pld1	A	T	3: 28,024,321	D43V	possibly damaging	Het
Ppp1r1b	C	A	11: 98,350,894	A51D	possibly damaging	Het
Prr23a1	T	A	9: 98,842,864	L93H	probably damaging	Het
Psg20	T	C	7: 18,684,659	D61G	probably benign	Het
Rab40b	T	A	11: 121,388,052	I31F	probably damaging	Het
Rasd2	T	C	8: 75,222,081	F212L	probably benign	Het
Rbl2	A	G	8: 91,115,193	I1006V	probably benign	Het
Sema6c	A	G	3: 95,167,060	E59G	probably benign	Het
Slc22a2	G	T	17: 12,606,057	V269L	possibly damaging	Het
Slc2a1	C	T	4: 119,132,612	P149S	probably damaging	Het
Smad4	T	G	18: 73,675,871	E108D	probably damaging	Het
Sorbs2	T	A	8: 45,795,656	I648K	probably benign	Het
Suclg1	A	T	6: 73,263,841	I118F	probably damaging	Het
Tet2	A	G	3: 133,480,229	I1149T	probably benign	Het
Tfr2	T	A	5: 137,571,489	Y82*	probably null	Het
Tfr2	G	T	5: 137,583,489	V613L	probably benign	Het
Tg	A	T	15: 66,696,161	M1305L	probably benign	Het
Tmem176a	A	T	6: 48,844,105	M170L	probably benign	Het
Trim71	T	C	9: 114,513,162	N684S	probably benign	Het
Tspan9	A	G	6: 127,965,251	I212T	probably benign	Het
Ttn	A	G	2: 76,942,975	V2361A	possibly damaging	Het
Uqcrc1	C	T	9: 108,936,759	T14M	possibly damaging	Het
Vmn2r11	T	C	5: 109,053,982	I219V	probably benign	Het
Vmn2r76	T	C	7: 86,225,369	H800R	probably benign	Het
Vmn2r76	C	T	7: 86,230,166	G309R	probably benign	Het
Xpc	A	T	6: 91,499,531	C529S	probably benign	Het
Zfp455	T	A	13: 67,207,624	S254T	possibly damaging	Het
Zfp746	T	C	6: 48,064,889	H301R	possibly damaging	Het
Zyg11a	A	T	4: 108,192,074	I490N	probably damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GCTCCAGAAAAGTTTCGGC -3'
(R):5'- TCTCCGGTAGAGGTTCAGTC -3'

Sequencing Primer
(F):5'- CTCCAGAAAAGTTTCGGCAAGTTG -3'
(R):5'- AGAGGTTCAGTCGCTGTTGAG -3'

Posted On

2019-10-17