Incidental Mutation 'R7524:Pld1'
ID582823
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28024321 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 43 (D43V)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539] [ENSMUST00000125338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067757
AA Change: D43V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: D43V

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120834
AA Change: D43V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: D43V

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: D43V

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125338
AA Change: D43V

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121318
Gene: ENSMUSG00000027695
AA Change: D43V

DomainStartEndE-ValueType
Pfam:PX 80 126 5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7440:Pld1 UTSW 3 28041270 missense probably benign 0.01
R7747:Pld1 UTSW 3 28087189 missense possibly damaging 0.66
R7882:Pld1 UTSW 3 28045009 missense probably damaging 1.00
R7965:Pld1 UTSW 3 28045009 missense probably damaging 1.00
R8033:Pld1 UTSW 3 28029210 missense not run
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Z1176:Pld1 UTSW 3 28076533 missense not run
Z1176:Pld1 UTSW 3 28131577 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTATCTGAGTGACACCTTG -3'
(R):5'- TGGTCGTTACTCAGAGTGGC -3'

Sequencing Primer
(F):5'- GACACCTTGTCTTTCTTCCCAG -3'
(R):5'- CTCAGAGTGGCCATTCTCTTAATGAG -3'
Posted On2019-10-17