Incidental Mutation 'R7524:Mms22l'
ID582828
Institutional Source Beutler Lab
Gene Symbol Mms22l
Ensembl Gene ENSMUSG00000045751
Gene NameMMS22-like, DNA repair protein
SynonymsF730047E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location24496451-24602950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24536138 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 536 (F536I)
Ref Sequence ENSEMBL: ENSMUSP00000057715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222] [ENSMUST00000154496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050446
AA Change: F536I

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: F536I

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 395 1.1e-199 PFAM
Pfam:MMS22L_N 392 690 4.6e-155 PFAM
low complexity region 698 711 N/A INTRINSIC
low complexity region 761 770 N/A INTRINSIC
Pfam:MMS22L_C 809 1186 2.3e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108222
AA Change: F576I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: F576I

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 730 N/A PFAM
low complexity region 738 751 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:MMS22L_C 849 1225 1.4e-142 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751
AA Change: F304I

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 459 1.3e-239 PFAM
low complexity region 467 480 N/A INTRINSIC
low complexity region 530 539 N/A INTRINSIC
Pfam:MMS22L_C 578 733 1.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154496
SMART Domains Protein: ENSMUSP00000134140
Gene: ENSMUSG00000045751

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 85 3.1e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Mms22l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Mms22l APN 4 24502805 missense probably damaging 1.00
IGL02158:Mms22l APN 4 24505349 missense probably damaging 0.98
IGL02533:Mms22l APN 4 24581099 splice site probably benign
IGL02612:Mms22l APN 4 24508482 missense probably benign 0.03
IGL02685:Mms22l APN 4 24591133 missense probably benign
IGL03000:Mms22l APN 4 24581161 missense probably damaging 0.99
IGL03006:Mms22l APN 4 24521253 missense probably damaging 1.00
PIT4280001:Mms22l UTSW 4 24581149 missense probably benign 0.08
R0157:Mms22l UTSW 4 24588224 missense probably damaging 1.00
R0279:Mms22l UTSW 4 24497867 missense probably damaging 1.00
R0669:Mms22l UTSW 4 24517223 missense probably benign 0.00
R1056:Mms22l UTSW 4 24586344 critical splice donor site probably null
R1232:Mms22l UTSW 4 24536274 missense probably benign 0.24
R1389:Mms22l UTSW 4 24591076 missense probably damaging 1.00
R1543:Mms22l UTSW 4 24591084 missense probably benign 0.41
R1604:Mms22l UTSW 4 24502804 missense probably damaging 1.00
R1872:Mms22l UTSW 4 24598807 missense probably damaging 0.99
R1929:Mms22l UTSW 4 24535936 unclassified probably benign
R2024:Mms22l UTSW 4 24588365 missense probably damaging 1.00
R2081:Mms22l UTSW 4 24536150 missense probably damaging 1.00
R2104:Mms22l UTSW 4 24591084 missense probably benign 0.41
R2147:Mms22l UTSW 4 24580063 nonsense probably null
R2379:Mms22l UTSW 4 24496929 missense possibly damaging 0.87
R2496:Mms22l UTSW 4 24521269 missense probably benign 0.31
R3508:Mms22l UTSW 4 24586224 missense probably benign 0.01
R3625:Mms22l UTSW 4 24505357 missense probably damaging 1.00
R3789:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R4422:Mms22l UTSW 4 24503008 missense probably damaging 1.00
R4623:Mms22l UTSW 4 24502792 nonsense probably null
R4799:Mms22l UTSW 4 24580052 critical splice acceptor site probably null
R4825:Mms22l UTSW 4 24536226 missense probably damaging 1.00
R5236:Mms22l UTSW 4 24588347 missense probably benign 0.02
R5276:Mms22l UTSW 4 24578774 missense probably damaging 1.00
R5364:Mms22l UTSW 4 24496882 unclassified probably benign
R5394:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R6905:Mms22l UTSW 4 24503107 missense probably benign 0.00
R7206:Mms22l UTSW 4 24591146 missense probably benign 0.00
R7290:Mms22l UTSW 4 24517139 missense probably benign
R7425:Mms22l UTSW 4 24596287 missense probably benign 0.15
R7536:Mms22l UTSW 4 24581240 missense probably damaging 0.99
R7722:Mms22l UTSW 4 24517201 missense probably damaging 1.00
R7757:Mms22l UTSW 4 24598884 critical splice donor site probably null
R7764:Mms22l UTSW 4 24598842 missense probably damaging 1.00
RF005:Mms22l UTSW 4 24517207 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAAGAACTAACTGAAGTTGGCC -3'
(R):5'- TGGCAGTAACATGCTAAATCCATC -3'

Sequencing Primer
(F):5'- AGTTGGCCTACAGAACTTTTTCAGC -3'
(R):5'- CCATCATTGAGAAGATGCTCATGAG -3'
Posted On2019-10-17