Incidental Mutation 'R7524:Tfr2'
ID582837
Institutional Source Beutler Lab
Gene Symbol Tfr2
Ensembl Gene ENSMUSG00000029716
Gene Nametransferrin receptor 2
SynonymsTrfr2, Tfr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137569840-137587481 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 137571489 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 82 (Y82*)
Ref Sequence ENSEMBL: ENSMUSP00000031729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000031729] [ENSMUST00000139395] [ENSMUST00000196471] [ENSMUST00000198601] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031725
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
ACTIN 11 379 4.16e-116 SMART
Predicted Effect probably null
Transcript: ENSMUST00000031729
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139395
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
ACTIN 11 426 5.96e-167 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196471
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198601
Predicted Effect probably null
Transcript: ENSMUST00000198783
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198866
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199054
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716
AA Change: Y82*

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutant mice exhibit iron homeostasis defects similar to those observed in human hemachromatosis. On a standard diet, mutant mice show periportal hepatic iron loading, splenic iron sparing, and elevated serum transferrin saturations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Tfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tfr2 APN 5 137574455 missense probably null
IGL00960:Tfr2 APN 5 137571692 missense probably benign 0.00
IGL01360:Tfr2 APN 5 137571691 missense probably benign
IGL02967:Tfr2 APN 5 137582819 nonsense probably null
IGL02996:Tfr2 APN 5 137583466 missense probably benign
IGL03278:Tfr2 APN 5 137571036 nonsense probably null
iron-man UTSW 5 137583153 splice site probably benign
R0114:Tfr2 UTSW 5 137577465 missense probably benign 0.00
R1384:Tfr2 UTSW 5 137586820 splice site probably benign
R1525:Tfr2 UTSW 5 137579030 missense probably benign 0.00
R1545:Tfr2 UTSW 5 137583299 missense probably benign 0.03
R1765:Tfr2 UTSW 5 137583445 missense probably damaging 0.98
R1908:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R1943:Tfr2 UTSW 5 137578921 missense probably benign
R3439:Tfr2 UTSW 5 137574651 missense probably benign 0.03
R4332:Tfr2 UTSW 5 137571734 missense probably damaging 1.00
R4626:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R4915:Tfr2 UTSW 5 137583411 missense probably damaging 0.96
R4999:Tfr2 UTSW 5 137586925 missense probably benign 0.00
R5150:Tfr2 UTSW 5 137574490 missense probably benign 0.22
R5200:Tfr2 UTSW 5 137570980 splice site probably benign
R5936:Tfr2 UTSW 5 137587006 missense probably benign 0.00
R6165:Tfr2 UTSW 5 137580257 missense probably damaging 0.97
R6513:Tfr2 UTSW 5 137574531 splice site probably null
R7076:Tfr2 UTSW 5 137583574 missense probably damaging 1.00
R7115:Tfr2 UTSW 5 137571715 missense probably benign
R7524:Tfr2 UTSW 5 137583489 missense probably benign 0.12
R7799:Tfr2 UTSW 5 137571724 missense possibly damaging 0.69
X0067:Tfr2 UTSW 5 137577548 missense probably benign 0.01
Z1176:Tfr2 UTSW 5 137571737 missense not run
Predicted Primers PCR Primer
(F):5'- ATCTACAGACGCGTGGAAGG -3'
(R):5'- GAGTCCTCAGGGTTGACATC -3'

Sequencing Primer
(F):5'- TGGAAGGCCCTCAGCTG -3'
(R):5'- AGGGTTGACATCTTCATCGAC -3'
Posted On2019-10-17