Incidental Mutation 'R7524:Tmem176a'
ID582840
Institutional Source Beutler Lab
Gene Symbol Tmem176a
Ensembl Gene ENSMUSG00000023367
Gene Nametransmembrane protein 176A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48840919-48847071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48844105 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 170 (M170L)
Ref Sequence ENSEMBL: ENSMUSP00000098969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101426] [ENSMUST00000101429] [ENSMUST00000164733] [ENSMUST00000166247] [ENSMUST00000168406] [ENSMUST00000203229] [ENSMUST00000203265] [ENSMUST00000203355] [ENSMUST00000203501] [ENSMUST00000203639] [ENSMUST00000204073] [ENSMUST00000204309] [ENSMUST00000204400] [ENSMUST00000204482] [ENSMUST00000204783] [ENSMUST00000205147] [ENSMUST00000205159]
Predicted Effect probably benign
Transcript: ENSMUST00000101426
AA Change: M170L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098969
Gene: ENSMUSG00000023367
AA Change: M170L

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101429
SMART Domains Protein: ENSMUSP00000098972
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164733
SMART Domains Protein: ENSMUSP00000128705
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166247
SMART Domains Protein: ENSMUSP00000131064
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168406
AA Change: M170L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131775
Gene: ENSMUSG00000023367
AA Change: M170L

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 2.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203229
SMART Domains Protein: ENSMUSP00000144865
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203265
SMART Domains Protein: ENSMUSP00000144869
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 194 2.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203355
SMART Domains Protein: ENSMUSP00000145395
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203501
SMART Domains Protein: ENSMUSP00000144742
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 170 3.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203639
AA Change: M170L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145250
Gene: ENSMUSG00000023367
AA Change: M170L

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204073
SMART Domains Protein: ENSMUSP00000144864
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204309
Predicted Effect probably benign
Transcript: ENSMUST00000204400
Predicted Effect probably benign
Transcript: ENSMUST00000204482
AA Change: M170L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145101
Gene: ENSMUSG00000023367
AA Change: M170L

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204783
SMART Domains Protein: ENSMUSP00000144810
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 1 58 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205147
SMART Domains Protein: ENSMUSP00000145235
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205159
SMART Domains Protein: ENSMUSP00000144949
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 60 196 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Tmem176a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Tmem176a APN 6 48842620 missense possibly damaging 0.93
R5329:Tmem176a UTSW 6 48842217 missense probably benign 0.00
R5391:Tmem176a UTSW 6 48844696 missense probably damaging 1.00
R6516:Tmem176a UTSW 6 48844068 unclassified probably null
R6846:Tmem176a UTSW 6 48843825 missense probably damaging 1.00
R7138:Tmem176a UTSW 6 48844019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGGCTAAAACTGAATC -3'
(R):5'- AGCAGTGGGAACAGTTTCTG -3'

Sequencing Primer
(F):5'- GCTGGCTAAAACTGAATCTTTGAGG -3'
(R):5'- CTCCTGTATCTTTAGAAACAATCACC -3'
Posted On2019-10-17