Incidental Mutation 'R7524:Sorbs2'
ID582856
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Namesorbin and SH3 domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45507788-45827906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45795656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 648 (I648K)
Ref Sequence ENSEMBL: ENSMUSP00000128000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067065
AA Change: I513K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: I513K

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
AA Change: I629K

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: I629K

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125295
AA Change: I568K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: I568K

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135336
AA Change: I629K

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: I629K

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171337
AA Change: I648K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: I648K

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 45799706 splice site probably null
IGL00964:Sorbs2 APN 8 45795677 missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 45745423 missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 45795594 missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 45795344 missense probably null
IGL01662:Sorbs2 APN 8 45803829 splice site probably benign
IGL01970:Sorbs2 APN 8 45745803 missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 45823749 missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 45803840 missense probably benign 0.00
IGL03036:Sorbs2 APN 8 45782865 missense probably benign
IGL03151:Sorbs2 APN 8 45799713 missense probably benign 0.01
IGL03164:Sorbs2 APN 8 45782874 missense probably benign 0.01
IGL03350:Sorbs2 APN 8 45805807 missense probably damaging 0.99
R0058:Sorbs2 UTSW 8 45785254 splice site probably null
R0058:Sorbs2 UTSW 8 45796263 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 45785337 splice site probably benign
R0306:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R0308:Sorbs2 UTSW 8 45795130 nonsense probably null
R0638:Sorbs2 UTSW 8 45796310 missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 45796502 missense probably benign 0.39
R1110:Sorbs2 UTSW 8 45795730 missense probably benign 0.13
R1160:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 45795619 missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 45795967 missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 45789963 splice site probably benign
R1514:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 45759197 splice site probably benign
R1582:Sorbs2 UTSW 8 45805777 missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 45769854 missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 45800984 missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 45763019 makesense probably null
R1766:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 45805696 missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 45796352 missense probably benign 0.01
R1954:Sorbs2 UTSW 8 45745738 missense probably benign 0.23
R2060:Sorbs2 UTSW 8 45775629 missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 45795443 missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 45795370 nonsense probably null
R3812:Sorbs2 UTSW 8 45763030 missense probably benign 0.00
R3831:Sorbs2 UTSW 8 45795095 missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 45772710 critical splice donor site probably null
R4033:Sorbs2 UTSW 8 45775595 missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 45795293 missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 45741615 intron probably benign
R4926:Sorbs2 UTSW 8 45796217 missense probably benign 0.03
R5027:Sorbs2 UTSW 8 45746534 intron probably null
R5118:Sorbs2 UTSW 8 45795785 missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R5342:Sorbs2 UTSW 8 45796013 missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 45819741 missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 45796001 missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 45741581 critical splice donor site probably null
R5687:Sorbs2 UTSW 8 45775632 missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 45792875 missense probably benign 0.27
R5733:Sorbs2 UTSW 8 45759189 missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 45763183 missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 45769897 critical splice donor site probably null
R6341:Sorbs2 UTSW 8 45770578 missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 45796176 missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 45772614 missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 45795823 nonsense probably null
R7404:Sorbs2 UTSW 8 45759196 splice site probably null
R7809:Sorbs2 UTSW 8 45745428 missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 45796556 missense probably null 0.16
Z1176:Sorbs2 UTSW 8 45790025 missense not run
Z1177:Sorbs2 UTSW 8 45782959 missense not run
Predicted Primers PCR Primer
(F):5'- TGAAATCCAGGATCCTGCAG -3'
(R):5'- TCGGACACAACCCCATCTTG -3'

Sequencing Primer
(F):5'- ATCCAGGATCCTGCAGTACGAG -3'
(R):5'- TGGTCACTGTCGGAAAACTC -3'
Posted On2019-10-17