Incidental Mutation 'R7524:Rasd2'
ID582858
Institutional Source Beutler Lab
Gene Symbol Rasd2
Ensembl Gene ENSMUSG00000034472
Gene NameRASD family, member 2
Synonyms4930526B11Rik, Rhes, TEM-2, TEM2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7524 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location75213944-75224113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75222081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 212 (F212L)
Ref Sequence ENSEMBL: ENSMUSP00000120717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132133] [ENSMUST00000139848]
Predicted Effect probably benign
Transcript: ENSMUST00000132133
AA Change: F212L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120717
Gene: ENSMUSG00000034472
AA Change: F212L

DomainStartEndE-ValueType
RAS 17 193 6.46e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139848
AA Change: F212L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118070
Gene: ENSMUSG00000034472
AA Change: F212L

DomainStartEndE-ValueType
RAS 17 193 6.46e-73 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras superfamily of small GTPases and is enriched in the striatum. The encoded protein functions as an E3 ligase for attachment of small ubiquitin-like modifier (SUMO). This protein also binds to mutant huntingtin (mHtt), the protein mutated in Huntington disease (HD). Sumoylation of mHTT by this protein may cause degeneration of the striatum. The protein functions as an activator of mechanistic target of rapamycin 1 (mTOR1), which in turn plays a role in myelination, axon growth and regeneration. Reduced levels of mRNA expressed by this gene were found in HD patients. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display reduced body weight, impaired motor coordination, hypoactivity, and a gender-dependent increase in anxiety levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Rasd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02874:Rasd2 APN 8 75218699 missense probably damaging 1.00
R3924:Rasd2 UTSW 8 75221974 missense probably damaging 1.00
R4254:Rasd2 UTSW 8 75221910 missense probably damaging 0.99
R4255:Rasd2 UTSW 8 75221910 missense probably damaging 0.99
R4664:Rasd2 UTSW 8 75221928 missense possibly damaging 0.88
R5006:Rasd2 UTSW 8 75218606 missense probably damaging 1.00
R5016:Rasd2 UTSW 8 75221975 missense probably damaging 1.00
R5052:Rasd2 UTSW 8 75221936 missense possibly damaging 0.89
R5951:Rasd2 UTSW 8 75222183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGGTGATCTGTGGGAACAAG -3'
(R):5'- CTCACTGGATGCTACACTTGTC -3'

Sequencing Primer
(F):5'- TCTGTGGGAACAAGAATGACCAC -3'
(R):5'- GGATGCTACACTTGTCCCTCTC -3'
Posted On2019-10-17