Incidental Mutation 'R7524:Uqcrc1'
ID 582864
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Name ubiquinol-cytochrome c reductase core protein 1
Synonyms 1110032G10Rik
MMRRC Submission 045596-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R7524 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108936633-108949623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108936759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 14 (T14M)
Ref Sequence ENSEMBL: ENSMUSP00000026743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000195738]
AlphaFold Q9CZ13
Predicted Effect possibly damaging
Transcript: ENSMUST00000026743
AA Change: T14M

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: T14M

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194047
AA Change: T14M

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651
AA Change: T14M

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 (GRCm38) C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 (GRCm38) E452V probably damaging Het
AI464131 C A 4: 41,498,779 (GRCm38) V284L probably benign Het
Ak6 A G 13: 100,663,907 (GRCm38) D45G probably benign Het
Arhgap17 G A 7: 123,306,420 (GRCm38) P334L probably damaging Het
Asns G T 6: 7,677,259 (GRCm38) probably null Het
Bend7 A G 2: 4,799,980 (GRCm38) T424A probably benign Het
Btbd2 C T 10: 80,646,444 (GRCm38) E241K probably damaging Het
Commd2 A C 3: 57,650,148 (GRCm38) L99W probably damaging Het
Cpne9 A T 6: 113,302,064 (GRCm38) D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 (GRCm38) F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 (GRCm38) F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 (GRCm38) Q234L probably benign Het
Dennd3 T G 15: 73,524,246 (GRCm38) Y201* probably null Het
Dnah17 T C 11: 118,121,481 (GRCm38) D485G probably benign Het
Dnah5 A T 15: 28,297,066 (GRCm38) T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 (GRCm38) D2167G probably damaging Het
Dst T C 1: 34,291,893 (GRCm38) V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 (GRCm38) Y736H probably damaging Het
Eri2 C G 7: 119,785,749 (GRCm38) V510L probably benign Het
Eya2 G A 2: 165,769,326 (GRCm38) probably null Het
Fam208a T A 14: 27,466,203 (GRCm38) C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 (GRCm38) Q181K probably benign Het
Fcgbp T C 7: 28,102,966 (GRCm38) S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 (GRCm38) V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 (GRCm38) S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 (GRCm38) Y3* probably null Het
Hagh G A 17: 24,861,340 (GRCm38) V226I probably benign Het
Hemk1 T A 9: 107,328,285 (GRCm38) I293F probably benign Het
Kcna3 A G 3: 107,037,207 (GRCm38) E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 (GRCm38) T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 (GRCm38) H7Q probably damaging Het
Knl1 A T 2: 119,065,979 (GRCm38) Q94L probably damaging Het
Krt12 T C 11: 99,419,659 (GRCm38) D224G probably damaging Het
Lats1 T A 10: 7,701,978 (GRCm38) S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 (GRCm38) A82G probably benign Het
Map1a G A 2: 121,289,812 (GRCm38) V60M probably damaging Het
Mms22l T A 4: 24,536,138 (GRCm38) F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 (GRCm38) T453A unknown Het
Muc3a A C 5: 137,210,563 (GRCm38) I151S probably benign Het
Oaf G A 9: 43,222,780 (GRCm38) R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 (GRCm38) M145L probably benign Het
Olfr1217 T A 2: 89,023,971 (GRCm38) I11L probably benign Het
Olfr1233 A G 2: 89,339,877 (GRCm38) C142R probably benign Het
Olfr1507 T C 14: 52,490,293 (GRCm38) I224V probably damaging Het
Olfr5 T C 7: 6,480,587 (GRCm38) N190D probably benign Het
Olfr8 T A 10: 78,955,491 (GRCm38) Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 (GRCm38) D352V probably benign Het
Pced1a A G 2: 130,422,028 (GRCm38) F235L probably benign Het
Pclo A G 5: 14,678,303 (GRCm38) I2392V unknown Het
Pld1 A T 3: 28,024,321 (GRCm38) D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 (GRCm38) A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 (GRCm38) L93H probably damaging Het
Psg20 T C 7: 18,684,659 (GRCm38) D61G probably benign Het
Rab40b T A 11: 121,388,052 (GRCm38) I31F probably damaging Het
Rasd2 T C 8: 75,222,081 (GRCm38) F212L probably benign Het
Rbl2 A G 8: 91,115,193 (GRCm38) I1006V probably benign Het
Sema6c A G 3: 95,167,060 (GRCm38) E59G probably benign Het
Slc22a2 G T 17: 12,606,057 (GRCm38) V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 (GRCm38) P149S probably damaging Het
Smad4 T G 18: 73,675,871 (GRCm38) E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 (GRCm38) I648K probably benign Het
Suclg1 A T 6: 73,263,841 (GRCm38) I118F probably damaging Het
Tet2 A G 3: 133,480,229 (GRCm38) I1149T probably benign Het
Tfr2 G T 5: 137,583,489 (GRCm38) V613L probably benign Het
Tfr2 T A 5: 137,571,489 (GRCm38) Y82* probably null Het
Tg A T 15: 66,696,161 (GRCm38) M1305L probably benign Het
Tmem176a A T 6: 48,844,105 (GRCm38) M170L probably benign Het
Trim71 T C 9: 114,513,162 (GRCm38) N684S probably benign Het
Tspan9 A G 6: 127,965,251 (GRCm38) I212T probably benign Het
Ttn A G 2: 76,942,975 (GRCm38) V2361A possibly damaging Het
Vmn2r11 T C 5: 109,053,982 (GRCm38) I219V probably benign Het
Vmn2r76 C T 7: 86,230,166 (GRCm38) G309R probably benign Het
Vmn2r76 T C 7: 86,225,369 (GRCm38) H800R probably benign Het
Xpc A T 6: 91,499,531 (GRCm38) C529S probably benign Het
Zfp455 T A 13: 67,207,624 (GRCm38) S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 (GRCm38) H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 (GRCm38) I490N probably damaging Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108,948,958 (GRCm38) missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108,947,869 (GRCm38) missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108,947,943 (GRCm38) critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108,948,574 (GRCm38) missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108,944,705 (GRCm38) nonsense probably null
R2027:Uqcrc1 UTSW 9 108,947,015 (GRCm38) missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108,936,768 (GRCm38) missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108,947,861 (GRCm38) missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108,944,810 (GRCm38) missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108,942,156 (GRCm38) missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108,947,405 (GRCm38) missense probably benign
R5941:Uqcrc1 UTSW 9 108,947,486 (GRCm38) unclassified probably benign
R6274:Uqcrc1 UTSW 9 108,942,156 (GRCm38) missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108,947,622 (GRCm38) missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108,949,468 (GRCm38) missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108,947,858 (GRCm38) missense probably benign 0.02
R8708:Uqcrc1 UTSW 9 108,947,040 (GRCm38) missense probably damaging 0.97
R8889:Uqcrc1 UTSW 9 108,937,118 (GRCm38) missense probably damaging 1.00
R8892:Uqcrc1 UTSW 9 108,937,118 (GRCm38) missense probably damaging 1.00
R8975:Uqcrc1 UTSW 9 108,947,653 (GRCm38) missense probably damaging 1.00
R9136:Uqcrc1 UTSW 9 108,947,905 (GRCm38) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCGATCAATTCTTGCTAACG -3'
(R):5'- GGCGACCATTGCAAGAACTG -3'

Sequencing Primer
(F):5'- GCGATCAATTCTTGCTAACGTACTTG -3'
(R):5'- TGGGACCTCGGCTCTCAAAC -3'
Posted On 2019-10-17