Incidental Mutation 'R7524:Or7a42'
ID 582867
Institutional Source Beutler Lab
Gene Symbol Or7a42
Ensembl Gene ENSMUSG00000094080
Gene Name olfactory receptor family 7 subfamily A member 42
Synonyms GA_x6K02T2QGN0-2857086-2856154, MOR139-5P, Olfr8
MMRRC Submission 045596-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R7524 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78791041-78791973 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 78791325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 95 (Y95*)
Ref Sequence ENSEMBL: ENSMUSP00000144916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
AlphaFold Q60892
Predicted Effect probably null
Transcript: ENSMUST00000081571
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: Y95*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203851
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: Y95*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214952
AA Change: Y95*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 56,325,395 (GRCm39) C353Y probably damaging Het
Afap1l2 T A 19: 56,906,543 (GRCm39) E452V probably damaging Het
Ak6 A G 13: 100,800,415 (GRCm39) D45G probably benign Het
Arhgap17 G A 7: 122,905,643 (GRCm39) P334L probably damaging Het
Asns G T 6: 7,677,259 (GRCm39) probably null Het
Bend7 A G 2: 4,804,791 (GRCm39) T424A probably benign Het
Btbd2 C T 10: 80,482,278 (GRCm39) E241K probably damaging Het
Commd2 A C 3: 57,557,569 (GRCm39) L99W probably damaging Het
Cpne9 A T 6: 113,279,025 (GRCm39) D473V probably damaging Het
Cuzd1 A T 7: 130,913,347 (GRCm39) F423L probably damaging Het
Cyp2d9 T C 15: 82,340,146 (GRCm39) F390L probably damaging Het
Dcaf5 T A 12: 80,423,470 (GRCm39) Q234L probably benign Het
Dennd3 T G 15: 73,396,095 (GRCm39) Y201* probably null Het
Dnah17 T C 11: 118,012,307 (GRCm39) D485G probably benign Het
Dnah5 A T 15: 28,297,212 (GRCm39) T1469S possibly damaging Het
Dnah6 T C 6: 73,095,082 (GRCm39) D2167G probably damaging Het
Dst T C 1: 34,330,974 (GRCm39) V4921A possibly damaging Het
Ephb2 A G 4: 136,387,020 (GRCm39) Y736H probably damaging Het
Eri2 C G 7: 119,384,972 (GRCm39) V510L probably benign Het
Eya2 G A 2: 165,611,246 (GRCm39) probably null Het
Fastkd5 G T 2: 130,458,048 (GRCm39) Q181K probably benign Het
Fcgbp T C 7: 27,802,391 (GRCm39) S1440P probably damaging Het
Fkbp9 G A 6: 56,845,725 (GRCm39) V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 (GRCm39) S304T probably benign Het
Gtf2a2 T A 9: 69,922,629 (GRCm39) Y3* probably null Het
Hagh G A 17: 25,080,314 (GRCm39) V226I probably benign Het
Hemk1 T A 9: 107,205,484 (GRCm39) I293F probably benign Het
Kcna3 A G 3: 106,944,523 (GRCm39) E262G probably damaging Het
Kcnt2 A T 1: 140,511,793 (GRCm39) T983S probably damaging Het
Klhdc3 A T 17: 46,989,340 (GRCm39) H7Q probably damaging Het
Knl1 A T 2: 118,896,460 (GRCm39) Q94L probably damaging Het
Krt12 T C 11: 99,310,485 (GRCm39) D224G probably damaging Het
Lats1 T A 10: 7,577,742 (GRCm39) S289T possibly damaging Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Map1a G A 2: 121,120,293 (GRCm39) V60M probably damaging Het
Mms22l T A 4: 24,536,138 (GRCm39) F536I possibly damaging Het
Ms4a14 T C 19: 11,281,200 (GRCm39) T453A unknown Het
Muc3a A C 5: 137,245,020 (GRCm39) I151S probably benign Het
Myorg C A 4: 41,498,779 (GRCm39) V284L probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Or4c112 T A 2: 88,854,315 (GRCm39) I11L probably benign Het
Or4c125 A G 2: 89,170,221 (GRCm39) C142R probably benign Het
Or4e5 T C 14: 52,727,750 (GRCm39) I224V probably damaging Het
Or5ar1 T A 2: 85,671,701 (GRCm39) M145L probably benign Het
Or6z7 T C 7: 6,483,586 (GRCm39) N190D probably benign Het
Pcdhgb4 A T 18: 37,854,661 (GRCm39) D352V probably benign Het
Pced1a A G 2: 130,263,948 (GRCm39) F235L probably benign Het
Pclo A G 5: 14,728,317 (GRCm39) I2392V unknown Het
Pld1 A T 3: 28,078,470 (GRCm39) D43V possibly damaging Het
Ppp1r1b C A 11: 98,241,720 (GRCm39) A51D possibly damaging Het
Prr23a1 T A 9: 98,724,917 (GRCm39) L93H probably damaging Het
Psg20 T C 7: 18,418,584 (GRCm39) D61G probably benign Het
Rab40b T A 11: 121,278,878 (GRCm39) I31F probably damaging Het
Rasd2 T C 8: 75,948,709 (GRCm39) F212L probably benign Het
Rbl2 A G 8: 91,841,821 (GRCm39) I1006V probably benign Het
Sema6c A G 3: 95,074,371 (GRCm39) E59G probably benign Het
Slc22a2 G T 17: 12,824,944 (GRCm39) V269L possibly damaging Het
Slc2a1 C T 4: 118,989,809 (GRCm39) P149S probably damaging Het
Smad4 T G 18: 73,808,942 (GRCm39) E108D probably damaging Het
Sorbs2 T A 8: 46,248,693 (GRCm39) I648K probably benign Het
Suclg1 A T 6: 73,240,824 (GRCm39) I118F probably damaging Het
Tasor T A 14: 27,188,160 (GRCm39) C869S probably damaging Het
Tet2 A G 3: 133,185,990 (GRCm39) I1149T probably benign Het
Tfr2 T A 5: 137,569,751 (GRCm39) Y82* probably null Het
Tfr2 G T 5: 137,581,751 (GRCm39) V613L probably benign Het
Tg A T 15: 66,568,010 (GRCm39) M1305L probably benign Het
Tmem176a A T 6: 48,821,039 (GRCm39) M170L probably benign Het
Trim71 T C 9: 114,342,230 (GRCm39) N684S probably benign Het
Tspan9 A G 6: 127,942,214 (GRCm39) I212T probably benign Het
Ttn A G 2: 76,773,319 (GRCm39) V2361A possibly damaging Het
Uqcrc1 C T 9: 108,765,827 (GRCm39) T14M possibly damaging Het
Vmn2r11 T C 5: 109,201,848 (GRCm39) I219V probably benign Het
Vmn2r76 T C 7: 85,874,577 (GRCm39) H800R probably benign Het
Vmn2r76 C T 7: 85,879,374 (GRCm39) G309R probably benign Het
Xpc A T 6: 91,476,513 (GRCm39) C529S probably benign Het
Zfp455 T A 13: 67,355,688 (GRCm39) S254T possibly damaging Het
Zfp746 T C 6: 48,041,823 (GRCm39) H301R possibly damaging Het
Zyg11a A T 4: 108,049,271 (GRCm39) I490N probably damaging Het
Other mutations in Or7a42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Or7a42 APN 10 78,791,188 (GRCm39) missense possibly damaging 0.48
IGL01480:Or7a42 APN 10 78,791,978 (GRCm39) utr 3 prime probably benign
IGL02505:Or7a42 APN 10 78,791,767 (GRCm39) missense probably benign 0.02
IGL02543:Or7a42 APN 10 78,791,773 (GRCm39) missense probably damaging 1.00
IGL03323:Or7a42 APN 10 78,791,434 (GRCm39) missense probably benign
PIT4466001:Or7a42 UTSW 10 78,791,676 (GRCm39) missense probably benign 0.00
R1496:Or7a42 UTSW 10 78,791,682 (GRCm39) missense probably benign 0.41
R1754:Or7a42 UTSW 10 78,791,531 (GRCm39) missense probably damaging 0.99
R1878:Or7a42 UTSW 10 78,791,639 (GRCm39) missense possibly damaging 0.62
R2760:Or7a42 UTSW 10 78,791,876 (GRCm39) missense probably damaging 0.99
R4202:Or7a42 UTSW 10 78,791,129 (GRCm39) missense probably benign
R4206:Or7a42 UTSW 10 78,791,117 (GRCm39) missense probably benign 0.00
R4517:Or7a42 UTSW 10 78,791,877 (GRCm39) nonsense probably null
R4613:Or7a42 UTSW 10 78,791,899 (GRCm39) missense probably damaging 1.00
R4799:Or7a42 UTSW 10 78,791,931 (GRCm39) missense probably null 0.92
R4979:Or7a42 UTSW 10 78,791,766 (GRCm39) nonsense probably null
R5008:Or7a42 UTSW 10 78,791,905 (GRCm39) missense probably damaging 1.00
R5700:Or7a42 UTSW 10 78,791,318 (GRCm39) missense probably damaging 1.00
R5876:Or7a42 UTSW 10 78,791,191 (GRCm39) missense probably benign 0.15
R6439:Or7a42 UTSW 10 78,791,818 (GRCm39) missense probably damaging 1.00
R6930:Or7a42 UTSW 10 78,791,615 (GRCm39) missense possibly damaging 0.84
R7110:Or7a42 UTSW 10 78,791,284 (GRCm39) missense possibly damaging 0.83
R7405:Or7a42 UTSW 10 78,791,531 (GRCm39) missense probably benign 0.14
R8198:Or7a42 UTSW 10 78,791,558 (GRCm39) missense probably damaging 0.97
R9227:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
R9230:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
Z1176:Or7a42 UTSW 10 78,791,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAACAGTGCTTGGGAAC -3'
(R):5'- CAAAAGGTCAACTGTAGCACAATTG -3'

Sequencing Primer
(F):5'- GGAACCTGCTCATCATCATGG -3'
(R):5'- CAACTGTAGCACAATTGAGCTCTG -3'
Posted On 2019-10-17